ID: 1158748755

View in Genome Browser
Species Human (GRCh38)
Location 18:60233466-60233488
Sequence TCATCTGTTTTCAAACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158748755_1158748758 24 Left 1158748755 18:60233466-60233488 CCTAAATGTTTGAAAACAGATGA No data
Right 1158748758 18:60233513-60233535 TTTTTCTTTTGGTTTAGCATAGG No data
1158748755_1158748756 13 Left 1158748755 18:60233466-60233488 CCTAAATGTTTGAAAACAGATGA No data
Right 1158748756 18:60233502-60233524 ATAAACCTACTTTTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158748755 Original CRISPR TCATCTGTTTTCAAACATTT AGG (reversed) Intergenic
No off target data available for this crispr