ID: 1158748756

View in Genome Browser
Species Human (GRCh38)
Location 18:60233502-60233524
Sequence ATAAACCTACTTTTTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158748755_1158748756 13 Left 1158748755 18:60233466-60233488 CCTAAATGTTTGAAAACAGATGA No data
Right 1158748756 18:60233502-60233524 ATAAACCTACTTTTTTCTTTTGG No data
1158748754_1158748756 17 Left 1158748754 18:60233462-60233484 CCATCCTAAATGTTTGAAAACAG No data
Right 1158748756 18:60233502-60233524 ATAAACCTACTTTTTTCTTTTGG No data
1158748753_1158748756 24 Left 1158748753 18:60233455-60233477 CCATTTGCCATCCTAAATGTTTG No data
Right 1158748756 18:60233502-60233524 ATAAACCTACTTTTTTCTTTTGG No data
1158748752_1158748756 28 Left 1158748752 18:60233451-60233473 CCTTCCATTTGCCATCCTAAATG No data
Right 1158748756 18:60233502-60233524 ATAAACCTACTTTTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158748756 Original CRISPR ATAAACCTACTTTTTTCTTT TGG Intergenic
No off target data available for this crispr