ID: 1158748758

View in Genome Browser
Species Human (GRCh38)
Location 18:60233513-60233535
Sequence TTTTTCTTTTGGTTTAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158748755_1158748758 24 Left 1158748755 18:60233466-60233488 CCTAAATGTTTGAAAACAGATGA No data
Right 1158748758 18:60233513-60233535 TTTTTCTTTTGGTTTAGCATAGG No data
1158748754_1158748758 28 Left 1158748754 18:60233462-60233484 CCATCCTAAATGTTTGAAAACAG No data
Right 1158748758 18:60233513-60233535 TTTTTCTTTTGGTTTAGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158748758 Original CRISPR TTTTTCTTTTGGTTTAGCAT AGG Intergenic
No off target data available for this crispr