ID: 1158750055

View in Genome Browser
Species Human (GRCh38)
Location 18:60248212-60248234
Sequence AACCCAGGGCACTCCCATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158750055_1158750063 18 Left 1158750055 18:60248212-60248234 CCCCTATGGGAGTGCCCTGGGTT No data
Right 1158750063 18:60248253-60248275 GTATTCCTTCTTCCTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158750055 Original CRISPR AACCCAGGGCACTCCCATAG GGG (reversed) Intergenic
No off target data available for this crispr