ID: 1158750544

View in Genome Browser
Species Human (GRCh38)
Location 18:60254209-60254231
Sequence TGTTAGTTAGAAGTCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158750544_1158750546 9 Left 1158750544 18:60254209-60254231 CCAACCAAGACTTCTAACTAACA No data
Right 1158750546 18:60254241-60254263 ATTTGAATATTTGAGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158750544 Original CRISPR TGTTAGTTAGAAGTCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr