ID: 1158751812

View in Genome Browser
Species Human (GRCh38)
Location 18:60270868-60270890
Sequence CTGGATATGCTTGGTTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158751807_1158751812 8 Left 1158751807 18:60270837-60270859 CCAGCTACACAGTTCTTTGCTAT No data
Right 1158751812 18:60270868-60270890 CTGGATATGCTTGGTTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158751812 Original CRISPR CTGGATATGCTTGGTTTTGA AGG Intergenic
No off target data available for this crispr