ID: 1158756192

View in Genome Browser
Species Human (GRCh38)
Location 18:60328396-60328418
Sequence CTTGCCTCTCTGGTTTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158756187_1158756192 7 Left 1158756187 18:60328366-60328388 CCCTCTGCAGGCTCTAAGGGAGA No data
Right 1158756192 18:60328396-60328418 CTTGCCTCTCTGGTTTCTGGTGG No data
1158756188_1158756192 6 Left 1158756188 18:60328367-60328389 CCTCTGCAGGCTCTAAGGGAGAT No data
Right 1158756192 18:60328396-60328418 CTTGCCTCTCTGGTTTCTGGTGG No data
1158756185_1158756192 10 Left 1158756185 18:60328363-60328385 CCTCCCTCTGCAGGCTCTAAGGG No data
Right 1158756192 18:60328396-60328418 CTTGCCTCTCTGGTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158756192 Original CRISPR CTTGCCTCTCTGGTTTCTGG TGG Intergenic
No off target data available for this crispr