ID: 1158760659

View in Genome Browser
Species Human (GRCh38)
Location 18:60381787-60381809
Sequence CCTGCTGCACAGTTATTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158760651_1158760659 12 Left 1158760651 18:60381752-60381774 CCCGCGTCTCCCTGTAATAGACC No data
Right 1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG No data
1158760654_1158760659 3 Left 1158760654 18:60381761-60381783 CCCTGTAATAGACCTGATTTGGT No data
Right 1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG No data
1158760656_1158760659 -9 Left 1158760656 18:60381773-60381795 CCTGATTTGGTATCCCTGCTGCA No data
Right 1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG No data
1158760652_1158760659 11 Left 1158760652 18:60381753-60381775 CCGCGTCTCCCTGTAATAGACCT No data
Right 1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG No data
1158760655_1158760659 2 Left 1158760655 18:60381762-60381784 CCTGTAATAGACCTGATTTGGTA No data
Right 1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158760659 Original CRISPR CCTGCTGCACAGTTATTGTC TGG Intergenic
No off target data available for this crispr