ID: 1158767060

View in Genome Browser
Species Human (GRCh38)
Location 18:60464342-60464364
Sequence CTTGTTCACAAAAGTGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158767059_1158767060 10 Left 1158767059 18:60464309-60464331 CCAGTTAGGAATCACTATCACAA No data
Right 1158767060 18:60464342-60464364 CTTGTTCACAAAAGTGTAAAAGG No data
1158767058_1158767060 11 Left 1158767058 18:60464308-60464330 CCCAGTTAGGAATCACTATCACA No data
Right 1158767060 18:60464342-60464364 CTTGTTCACAAAAGTGTAAAAGG No data
1158767055_1158767060 18 Left 1158767055 18:60464301-60464323 CCACTCCCCCAGTTAGGAATCAC No data
Right 1158767060 18:60464342-60464364 CTTGTTCACAAAAGTGTAAAAGG No data
1158767057_1158767060 12 Left 1158767057 18:60464307-60464329 CCCCAGTTAGGAATCACTATCAC No data
Right 1158767060 18:60464342-60464364 CTTGTTCACAAAAGTGTAAAAGG No data
1158767056_1158767060 13 Left 1158767056 18:60464306-60464328 CCCCCAGTTAGGAATCACTATCA No data
Right 1158767060 18:60464342-60464364 CTTGTTCACAAAAGTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158767060 Original CRISPR CTTGTTCACAAAAGTGTAAA AGG Intergenic