ID: 1158768517

View in Genome Browser
Species Human (GRCh38)
Location 18:60485787-60485809
Sequence TGTGAAGGCCAGGACCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158768507_1158768517 22 Left 1158768507 18:60485742-60485764 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768511_1158768517 16 Left 1158768511 18:60485748-60485770 CCAAATCTCATCTTGAATGTAAT 0: 4
1: 26
2: 123
3: 925
4: 10486
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768513_1158768517 -8 Left 1158768513 18:60485772-60485794 CCCATAATCTTTATGTGTGAAGG No data
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768509_1158768517 20 Left 1158768509 18:60485744-60485766 CCACCCAAATCTCATCTTGAATG 0: 104
1: 7793
2: 11440
3: 10277
4: 8638
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768515_1158768517 -9 Left 1158768515 18:60485773-60485795 CCATAATCTTTATGTGTGAAGGC No data
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768512_1158768517 -7 Left 1158768512 18:60485771-60485793 CCCCATAATCTTTATGTGTGAAG No data
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768510_1158768517 17 Left 1158768510 18:60485747-60485769 CCCAAATCTCATCTTGAATGTAA 0: 4
1: 53
2: 618
3: 9199
4: 13197
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data
1158768508_1158768517 21 Left 1158768508 18:60485743-60485765 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1158768517 18:60485787-60485809 TGTGAAGGCCAGGACCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158768517 Original CRISPR TGTGAAGGCCAGGACCTGAT AGG Intergenic
No off target data available for this crispr