ID: 1158769389

View in Genome Browser
Species Human (GRCh38)
Location 18:60496181-60496203
Sequence TAGCTAATGCTACCACACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158769389_1158769399 23 Left 1158769389 18:60496181-60496203 CCTGAGTGTGGTAGCATTAGCTA No data
Right 1158769399 18:60496227-60496249 CATGGGGGTGATGGCTGAGTAGG No data
1158769389_1158769394 14 Left 1158769389 18:60496181-60496203 CCTGAGTGTGGTAGCATTAGCTA No data
Right 1158769394 18:60496218-60496240 TTTGTCCCCCATGGGGGTGATGG No data
1158769389_1158769392 7 Left 1158769389 18:60496181-60496203 CCTGAGTGTGGTAGCATTAGCTA No data
Right 1158769392 18:60496211-60496233 GTTATAATTTGTCCCCCATGGGG No data
1158769389_1158769391 6 Left 1158769389 18:60496181-60496203 CCTGAGTGTGGTAGCATTAGCTA No data
Right 1158769391 18:60496210-60496232 TGTTATAATTTGTCCCCCATGGG No data
1158769389_1158769390 5 Left 1158769389 18:60496181-60496203 CCTGAGTGTGGTAGCATTAGCTA No data
Right 1158769390 18:60496209-60496231 TTGTTATAATTTGTCCCCCATGG No data
1158769389_1158769393 8 Left 1158769389 18:60496181-60496203 CCTGAGTGTGGTAGCATTAGCTA No data
Right 1158769393 18:60496212-60496234 TTATAATTTGTCCCCCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158769389 Original CRISPR TAGCTAATGCTACCACACTC AGG (reversed) Intergenic
No off target data available for this crispr