ID: 1158771977

View in Genome Browser
Species Human (GRCh38)
Location 18:60529874-60529896
Sequence CCTGCAAGACGGTGGCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158771977_1158771986 -10 Left 1158771977 18:60529874-60529896 CCTCAGTGCCACCGTCTTGCAGG No data
Right 1158771986 18:60529887-60529909 GTCTTGCAGGGATGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158771977 Original CRISPR CCTGCAAGACGGTGGCACTG AGG (reversed) Intergenic
No off target data available for this crispr