ID: 1158775665

View in Genome Browser
Species Human (GRCh38)
Location 18:60575527-60575549
Sequence GTTCAAACACACAATTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158775655_1158775665 25 Left 1158775655 18:60575479-60575501 CCTGCCCCTACCTTGAAGGGAAT No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data
1158775658_1158775665 19 Left 1158775658 18:60575485-60575507 CCTACCTTGAAGGGAATTTATAC No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data
1158775657_1158775665 20 Left 1158775657 18:60575484-60575506 CCCTACCTTGAAGGGAATTTATA No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data
1158775659_1158775665 15 Left 1158775659 18:60575489-60575511 CCTTGAAGGGAATTTATACCCAG No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data
1158775663_1158775665 -3 Left 1158775663 18:60575507-60575529 CCCAGGAATGGGCATCACATGTT No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data
1158775656_1158775665 21 Left 1158775656 18:60575483-60575505 CCCCTACCTTGAAGGGAATTTAT No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data
1158775664_1158775665 -4 Left 1158775664 18:60575508-60575530 CCAGGAATGGGCATCACATGTTC No data
Right 1158775665 18:60575527-60575549 GTTCAAACACACAATTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158775665 Original CRISPR GTTCAAACACACAATTACAG TGG Intergenic
No off target data available for this crispr