ID: 1158782375

View in Genome Browser
Species Human (GRCh38)
Location 18:60666856-60666878
Sequence TTACATAGGTTGGAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158782375_1158782380 -3 Left 1158782375 18:60666856-60666878 CCTGTTTGTTCCAACCTATGTAA No data
Right 1158782380 18:60666876-60666898 TAATTTCCAGGAATTTCAATGGG No data
1158782375_1158782379 -4 Left 1158782375 18:60666856-60666878 CCTGTTTGTTCCAACCTATGTAA No data
Right 1158782379 18:60666875-60666897 GTAATTTCCAGGAATTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158782375 Original CRISPR TTACATAGGTTGGAACAAAC AGG (reversed) Intergenic
No off target data available for this crispr