ID: 1158788539

View in Genome Browser
Species Human (GRCh38)
Location 18:60745620-60745642
Sequence CACCTTTCTGTGACATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158788539_1158788544 20 Left 1158788539 18:60745620-60745642 CCATAGGATGTCACAGAAAGGTG No data
Right 1158788544 18:60745663-60745685 GAGGAAAGTCATCTTATTGAGGG No data
1158788539_1158788543 19 Left 1158788539 18:60745620-60745642 CCATAGGATGTCACAGAAAGGTG No data
Right 1158788543 18:60745662-60745684 AGAGGAAAGTCATCTTATTGAGG No data
1158788539_1158788541 1 Left 1158788539 18:60745620-60745642 CCATAGGATGTCACAGAAAGGTG No data
Right 1158788541 18:60745644-60745666 CAAATCTACAAAATCCACAGAGG No data
1158788539_1158788545 24 Left 1158788539 18:60745620-60745642 CCATAGGATGTCACAGAAAGGTG No data
Right 1158788545 18:60745667-60745689 AAAGTCATCTTATTGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158788539 Original CRISPR CACCTTTCTGTGACATCCTA TGG (reversed) Intergenic
No off target data available for this crispr