ID: 1158789128

View in Genome Browser
Species Human (GRCh38)
Location 18:60754447-60754469
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 13, 1: 48, 2: 64, 3: 98, 4: 529}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158789128 Original CRISPR CTGAATATACAAATGGACAA GGG Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904985872 1:34548249-34548271 CTGAATATAAAATTGTAAAATGG - Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
908507342 1:64817936-64817958 TTCATTATACAAATGGAGAAGGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909150948 1:72004137-72004159 ATAAATATATAATTGGACAAAGG - Intronic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
910154616 1:84200550-84200572 CTGGACATAAGAATGGACAAAGG - Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911509662 1:98795756-98795778 ATGGAAATAAAAATGGACAAAGG - Intergenic
911584337 1:99672952-99672974 CAGATGATACAAATGGGCAAAGG + Intronic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063336008 10:5214536-5214558 CTGAATATTCATATGGTCTATGG - Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066785529 10:39000033-39000055 GAGAATATACAAAGGGACATTGG - Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071684446 10:87739945-87739967 CTACATATACCAATGTACAATGG + Intronic
1072504341 10:96049272-96049294 CTAATTATAAAAATGGGCAAAGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079621724 11:22563909-22563931 CTGGACATAGGAATGGACAAAGG - Intergenic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1080944469 11:36956040-36956062 CTGAATATACAATTTGAAATAGG - Intergenic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081902424 11:46640316-46640338 CTGAATATACTAACAGACAGTGG - Intronic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1090037716 11:123263282-123263304 CTGGCTATACTAACGGACAATGG - Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092333200 12:7604238-7604260 CTGAAAATACACATGGCCATTGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106282144 13:28284299-28284321 TTGAAAATAAAAATGGGCAAAGG - Intronic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1106944509 13:34811735-34811757 CTCAATATACAAAGGGATAGGGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116104332 14:40480872-40480894 CTGAATTTAAGAATGGCCAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116111415 14:40590267-40590289 CTGATTGTACAAATGTTCAAAGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117056791 14:51920257-51920279 CTGAAGATATCAAGGGACAACGG + Intronic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119497236 14:75090344-75090366 GAGAAAATACAAATGGGCAAAGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121751338 14:96359900-96359922 TTTAATATACAAATGGGCACTGG + Intronic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124640749 15:31394704-31394726 GTGAATATACTAAAGGCCAATGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131492551 15:92875537-92875559 CTGATTATTTAAATGGGCAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136061197 16:27727650-27727672 CTGAAAATGCAAATGGTCATAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1147522262 17:41184926-41184948 CTGAGTATAAAAGTGGACATGGG - Exonic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1154128275 18:11713618-11713640 CTGAATATATAAACAGGCAATGG - Intronic
1155068345 18:22288509-22288531 ATGGAAATACAAATGGCCAAGGG - Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156088468 18:33438026-33438048 CTGAAAATATAAAGGGACTATGG + Intronic
1156946517 18:42839749-42839771 ATGAACATACGAATGGACAGTGG + Intronic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158152753 18:54390870-54390892 CAGAAAATACAAATTGCCAAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161639418 19:5411607-5411629 GACAATATACAAATGGCCAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1164434992 19:28221366-28221388 CTGGACATACAACTGGACAGTGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168514329 19:56998363-56998385 CCGAATGTGCAAATGCACAAGGG + Intergenic
1168566975 19:57433442-57433464 TTTGCTATACAAATGGACAACGG - Intronic
925175959 2:1784071-1784093 ATGAAAATACAAGCGGACAATGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
933522865 2:83394800-83394822 TTGAACATACAAAAGGGCAATGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941288331 2:163643355-163643377 CACAATATACAAATGTACAGGGG + Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
943528375 2:189047468-189047490 TTTAATATACAAATGCCCAATGG + Intronic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944865960 2:203862052-203862074 CTGAATATTCAAATGTCTAAGGG - Intergenic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
946635348 2:221719016-221719038 CTGCATATACAAGCAGACAATGG + Intergenic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175638015 20:60601763-60601785 GAGAATATACAAGTGGACTACGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178183681 21:30194213-30194235 CTGGACATATAAGTGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1184966962 22:47983859-47983881 CACAATTTACCAATGGACAAAGG - Intergenic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952546551 3:34426158-34426180 CTGAAAATACAAGAGGACCAAGG + Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953275046 3:41486807-41486829 TTGTGTATACAAATGGTCAATGG - Intronic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970632760 4:17969712-17969734 CTGAGTTTACGAATGAACAAAGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
979353856 4:119679093-119679115 CAGCAAATATAAATGGACAAAGG + Intergenic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987588440 5:19890458-19890480 TTGAATATATAAATGTCCAATGG + Intronic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992307593 5:75459323-75459345 CTGAAGATAAGAATGTACAAAGG + Intronic
992882196 5:81121449-81121471 ATGACAATAAAAATGGACAAAGG - Intronic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
994348670 5:98718857-98718879 CAGAATATAGGCATGGACAAAGG + Intergenic
995243689 5:109913721-109913743 CTGCATATATCTATGGACAAGGG + Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996647199 5:125830256-125830278 ATGAAAATAGAAAGGGACAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999625492 5:153516451-153516473 CTGATTTTACCAATGAACAAAGG + Intronic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999912236 5:156215498-156215520 CCTGATTTACAAATGGACAAAGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1006861866 6:37177154-37177176 CTTAATATATGAATTGACAATGG - Intergenic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008168657 6:48173863-48173885 GTGAATATACAAATTTCCAAAGG + Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014271617 6:119342871-119342893 CTGTATATACAAAGGGTGAAAGG - Intronic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015132407 6:129828302-129828324 AAGAACATACAAATGGTCAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015276945 6:131392504-131392526 CTCAATTTACCAATGAACAAAGG + Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017349934 6:153428024-153428046 CTGGATATGTGAATGGACAATGG - Intergenic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018929397 6:168230659-168230681 CTGAATATACGAAGGGACGCTGG + Intergenic
1019773353 7:2897358-2897380 CTGAGTATAAAAATGGTCACTGG + Intergenic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022047743 7:26636205-26636227 CTGTGTATACCAAGGGACAACGG + Intergenic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028147463 7:87334233-87334255 CTGATTATAAAAATTGGCAAAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG + Intronic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040460808 8:47646117-47646139 CTCAGTATAAAAATGGGCAAAGG + Intronic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041384388 8:57283590-57283612 CGGTATATACAATAGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041947057 8:63457278-63457300 ATGAAAATATAAATGTACAAAGG - Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045640924 8:104249435-104249457 TTTAATATACAAATGCACTAAGG - Intronic
1046151086 8:110227076-110227098 CCCAATTTACAAATGGTCAAAGG - Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047789503 8:128188279-128188301 CTCAATTTACTAATGGTCAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051042969 9:12836813-12836835 CTGAATATACAAATACACTCTGG + Intergenic
1051581419 9:18680211-18680233 CTGATTATACCAATAGACATGGG + Intronic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1052244229 9:26314219-26314241 CTGAATATAGAAATGGTCTTGGG + Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058471879 9:105288117-105288139 CTGATTATACAAATATGCAAAGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1061426769 9:130503873-130503895 CTAAATATATAAATGGGGAAAGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1190089169 X:47422468-47422490 CTATAAATAAAAATGGACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195304945 X:103572773-103572795 CTGAATTTACAAGAGGAAAATGG - Intergenic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197847636 X:130820129-130820151 CCGATTTTAAAAATGGACAAAGG + Intronic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199888665 X:152051074-152051096 CTCCATTTACAAATGGTCAATGG - Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200781479 Y:7220248-7220270 CTGAAAATATAAACAGACAATGG + Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic