ID: 1158790106

View in Genome Browser
Species Human (GRCh38)
Location 18:60769073-60769095
Sequence GTGCCCAATGTTCAGTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158790100_1158790106 27 Left 1158790100 18:60769023-60769045 CCATGGAACATAACCCTTTACTT No data
Right 1158790106 18:60769073-60769095 GTGCCCAATGTTCAGTTTGTTGG No data
1158790101_1158790106 14 Left 1158790101 18:60769036-60769058 CCCTTTACTTCCTCTTCAAAACA No data
Right 1158790106 18:60769073-60769095 GTGCCCAATGTTCAGTTTGTTGG No data
1158790102_1158790106 13 Left 1158790102 18:60769037-60769059 CCTTTACTTCCTCTTCAAAACAA No data
Right 1158790106 18:60769073-60769095 GTGCCCAATGTTCAGTTTGTTGG No data
1158790103_1158790106 4 Left 1158790103 18:60769046-60769068 CCTCTTCAAAACAAAAAGAAAGG No data
Right 1158790106 18:60769073-60769095 GTGCCCAATGTTCAGTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158790106 Original CRISPR GTGCCCAATGTTCAGTTTGT TGG Intergenic
No off target data available for this crispr