ID: 1158793170

View in Genome Browser
Species Human (GRCh38)
Location 18:60806955-60806977
Sequence CTAGGAACACAGATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158793167_1158793170 13 Left 1158793167 18:60806919-60806941 CCTTGGAAGAATTATTCATTGAT No data
Right 1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG No data
1158793166_1158793170 23 Left 1158793166 18:60806909-60806931 CCTTTATCTGCCTTGGAAGAATT No data
Right 1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158793170 Original CRISPR CTAGGAACACAGATGGAAAA TGG Intergenic
No off target data available for this crispr