ID: 1158800523

View in Genome Browser
Species Human (GRCh38)
Location 18:60903098-60903120
Sequence GGTGTAATGAGCCCAAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158800520_1158800523 28 Left 1158800520 18:60903047-60903069 CCATAAATATATTGAGGGAAGCT No data
Right 1158800523 18:60903098-60903120 GGTGTAATGAGCCCAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158800523 Original CRISPR GGTGTAATGAGCCCAAACAT AGG Intergenic
No off target data available for this crispr