ID: 1158805650

View in Genome Browser
Species Human (GRCh38)
Location 18:60968861-60968883
Sequence ACAGAGATGCTGACTGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158805650_1158805652 10 Left 1158805650 18:60968861-60968883 CCCTACACAGTCAGCATCTCTGT No data
Right 1158805652 18:60968894-60968916 TCTCATATCACTCTTACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158805650 Original CRISPR ACAGAGATGCTGACTGTGTA GGG (reversed) Intergenic
No off target data available for this crispr