ID: 1158813740

View in Genome Browser
Species Human (GRCh38)
Location 18:61069315-61069337
Sequence ATGCAGAAGCAGAGTATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158813740_1158813743 5 Left 1158813740 18:61069315-61069337 CCTTCCATACTCTGCTTCTGCAT No data
Right 1158813743 18:61069343-61069365 CCTTTAAAATGTGATGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158813740 Original CRISPR ATGCAGAAGCAGAGTATGGA AGG (reversed) Intergenic
No off target data available for this crispr