ID: 1158819596

View in Genome Browser
Species Human (GRCh38)
Location 18:61144337-61144359
Sequence GGGGTTGGTGGTTTGAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158819596_1158819600 -6 Left 1158819596 18:61144337-61144359 CCACTCTTCAAACCACCAACCCC No data
Right 1158819600 18:61144354-61144376 AACCCCTTTGCTGCAACTGAGGG No data
1158819596_1158819601 -5 Left 1158819596 18:61144337-61144359 CCACTCTTCAAACCACCAACCCC No data
Right 1158819601 18:61144355-61144377 ACCCCTTTGCTGCAACTGAGGGG No data
1158819596_1158819599 -7 Left 1158819596 18:61144337-61144359 CCACTCTTCAAACCACCAACCCC No data
Right 1158819599 18:61144353-61144375 CAACCCCTTTGCTGCAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158819596 Original CRISPR GGGGTTGGTGGTTTGAAGAG TGG (reversed) Intergenic
No off target data available for this crispr