ID: 1158819601

View in Genome Browser
Species Human (GRCh38)
Location 18:61144355-61144377
Sequence ACCCCTTTGCTGCAACTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158819596_1158819601 -5 Left 1158819596 18:61144337-61144359 CCACTCTTCAAACCACCAACCCC No data
Right 1158819601 18:61144355-61144377 ACCCCTTTGCTGCAACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158819601 Original CRISPR ACCCCTTTGCTGCAACTGAG GGG Intergenic
No off target data available for this crispr