ID: 1158825049

View in Genome Browser
Species Human (GRCh38)
Location 18:61209124-61209146
Sequence CAGAAGGTCTGGTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158825049_1158825054 5 Left 1158825049 18:61209124-61209146 CCATCTTCCCACCAGACCTTCTG No data
Right 1158825054 18:61209152-61209174 TGAAACTGTCAGAAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158825049 Original CRISPR CAGAAGGTCTGGTGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr