ID: 1158825943

View in Genome Browser
Species Human (GRCh38)
Location 18:61219408-61219430
Sequence ATCTTTCCCTATAAGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158825941_1158825943 16 Left 1158825941 18:61219369-61219391 CCTTGCTTACCATGGTATGAAGC No data
Right 1158825943 18:61219408-61219430 ATCTTTCCCTATAAGATGTATGG No data
1158825942_1158825943 7 Left 1158825942 18:61219378-61219400 CCATGGTATGAAGCAGCATTAAC No data
Right 1158825943 18:61219408-61219430 ATCTTTCCCTATAAGATGTATGG No data
1158825939_1158825943 27 Left 1158825939 18:61219358-61219380 CCTAACTTATGCCTTGCTTACCA No data
Right 1158825943 18:61219408-61219430 ATCTTTCCCTATAAGATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158825943 Original CRISPR ATCTTTCCCTATAAGATGTA TGG Intergenic
No off target data available for this crispr