ID: 1158829685

View in Genome Browser
Species Human (GRCh38)
Location 18:61263746-61263768
Sequence AAATTGCCACAGAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158829676_1158829685 16 Left 1158829676 18:61263707-61263729 CCACAGGGATCCTTCGAAAGGGT No data
Right 1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG No data
1158829673_1158829685 26 Left 1158829673 18:61263697-61263719 CCTGCTGACACCACAGGGATCCT No data
Right 1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG No data
1158829683_1158829685 -9 Left 1158829683 18:61263732-61263754 CCAGAGGCATGGGGAAATTGCCA No data
Right 1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG No data
1158829682_1158829685 -8 Left 1158829682 18:61263731-61263753 CCCAGAGGCATGGGGAAATTGCC No data
Right 1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG No data
1158829678_1158829685 6 Left 1158829678 18:61263717-61263739 CCTTCGAAAGGGTGCCCAGAGGC No data
Right 1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158829685 Original CRISPR AAATTGCCACAGAGAGAAGG AGG Intergenic
No off target data available for this crispr