ID: 1158830599 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:61273603-61273625 |
Sequence | CTTCATTTCCGCCCAGATGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158830599_1158830600 | 29 | Left | 1158830599 | 18:61273603-61273625 | CCAGCATCTGGGCGGAAATGAAG | No data | ||
Right | 1158830600 | 18:61273655-61273677 | ATTGCATAACCTCTGTTCTTTGG | No data | ||||
1158830599_1158830601 | 30 | Left | 1158830599 | 18:61273603-61273625 | CCAGCATCTGGGCGGAAATGAAG | No data | ||
Right | 1158830601 | 18:61273656-61273678 | TTGCATAACCTCTGTTCTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158830599 | Original CRISPR | CTTCATTTCCGCCCAGATGC TGG (reversed) | Intergenic | ||