ID: 1158830599

View in Genome Browser
Species Human (GRCh38)
Location 18:61273603-61273625
Sequence CTTCATTTCCGCCCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158830599_1158830601 30 Left 1158830599 18:61273603-61273625 CCAGCATCTGGGCGGAAATGAAG No data
Right 1158830601 18:61273656-61273678 TTGCATAACCTCTGTTCTTTGGG No data
1158830599_1158830600 29 Left 1158830599 18:61273603-61273625 CCAGCATCTGGGCGGAAATGAAG No data
Right 1158830600 18:61273655-61273677 ATTGCATAACCTCTGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158830599 Original CRISPR CTTCATTTCCGCCCAGATGC TGG (reversed) Intergenic
No off target data available for this crispr