ID: 1158830601

View in Genome Browser
Species Human (GRCh38)
Location 18:61273656-61273678
Sequence TTGCATAACCTCTGTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158830599_1158830601 30 Left 1158830599 18:61273603-61273625 CCAGCATCTGGGCGGAAATGAAG No data
Right 1158830601 18:61273656-61273678 TTGCATAACCTCTGTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158830601 Original CRISPR TTGCATAACCTCTGTTCTTT GGG Intergenic
No off target data available for this crispr