ID: 1158836104

View in Genome Browser
Species Human (GRCh38)
Location 18:61333535-61333557
Sequence CGCGGTGGCCGCGGGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 424}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158836095_1158836104 8 Left 1158836095 18:61333504-61333526 CCAGGGGGCTCTTCTCACTGGAC 0: 1
1: 0
2: 0
3: 21
4: 148
Right 1158836104 18:61333535-61333557 CGCGGTGGCCGCGGGAGGGCAGG 0: 1
1: 0
2: 4
3: 48
4: 424
1158836093_1158836104 14 Left 1158836093 18:61333498-61333520 CCGCGACCAGGGGGCTCTTCTCA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 1158836104 18:61333535-61333557 CGCGGTGGCCGCGGGAGGGCAGG 0: 1
1: 0
2: 4
3: 48
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158836104 Original CRISPR CGCGGTGGCCGCGGGAGGGC AGG Intergenic