ID: 1158839194

View in Genome Browser
Species Human (GRCh38)
Location 18:61365308-61365330
Sequence CAGTGGGACCCGACAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158839194_1158839200 28 Left 1158839194 18:61365308-61365330 CCATCTTCTGTCGGGTCCCACTG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1158839200 18:61365359-61365381 TTAAATGGTCCCAGATGCTATGG 0: 1
1: 0
2: 1
3: 11
4: 136
1158839194_1158839198 13 Left 1158839194 18:61365308-61365330 CCATCTTCTGTCGGGTCCCACTG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1158839198 18:61365344-61365366 CTGTCTGCCTCTATATTAAATGG 0: 1
1: 0
2: 0
3: 21
4: 210
1158839194_1158839201 29 Left 1158839194 18:61365308-61365330 CCATCTTCTGTCGGGTCCCACTG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1158839201 18:61365360-61365382 TAAATGGTCCCAGATGCTATGGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158839194 Original CRISPR CAGTGGGACCCGACAGAAGA TGG (reversed) Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
910763330 1:90756651-90756673 AAATGGGAACCCACAGAAGAAGG - Intergenic
919871631 1:201826265-201826287 CAGTAAGACCCCACAGGAGATGG - Exonic
920924435 1:210328727-210328749 CAGTGGGAACCAACAGCCGAGGG + Intronic
921286932 1:213617271-213617293 CAGTGGGACCTGGCAGAATATGG - Intergenic
922233926 1:223709060-223709082 CAGTGGGAGCTGACAGGAAAAGG + Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922471019 1:225877365-225877387 CAGTGGGACACGACTCATGAGGG + Intronic
923618819 1:235560413-235560435 CAGTGTCACCCCACAGCAGATGG - Intronic
1064126540 10:12666379-12666401 CACTGGGAGACAACAGAAGAGGG + Intronic
1064891894 10:20184983-20185005 CACTGGGACCCGTCAGGGGATGG + Intronic
1069745697 10:70713535-70713557 CAGTGGAACCCAGCAGCAGATGG + Intronic
1071660816 10:87500799-87500821 CAGTGGAAGCCAACAGAAGAGGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072465533 10:95658737-95658759 CAGTAGGACATGACAGGAGAGGG + Intergenic
1073337060 10:102717509-102717531 TAGTGGGACCATACAGAAGTGGG + Intronic
1074180875 10:111061590-111061612 CAGTGGCATCCTACGGAAGAGGG + Intergenic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074418289 10:113286407-113286429 CAGAGGGACCAGATACAAGAGGG - Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075717803 10:124566988-124567010 CACTGGGACCCCACAGAGGCAGG + Intronic
1075798699 10:125138882-125138904 CAGTGGGACTCATCAGAAGCCGG - Intronic
1076320947 10:129580944-129580966 CAGTGGGACCAGACAGCGGCTGG - Intronic
1083533726 11:63449267-63449289 CAGTGGTACACTCCAGAAGATGG + Intergenic
1084283714 11:68117870-68117892 CAAAGGGACCAGACAGAAGGTGG + Intronic
1085085958 11:73666912-73666934 CAGTGGGTCCAGACAGACTAAGG - Intergenic
1086096237 11:83052620-83052642 CAGGGGAACACGAGAGAAGAAGG + Intronic
1086820274 11:91427770-91427792 CACTGGGACCTGACAGAGGTTGG - Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1089737949 11:120562908-120562930 CAGCTGGACCCTGCAGAAGAGGG - Intronic
1095971445 12:47904633-47904655 CAAGGCGCCCCGACAGAAGAAGG + Exonic
1099263637 12:80416278-80416300 CAGTGGGAACCTTCACAAGATGG + Intronic
1101877953 12:108607895-108607917 CAGAGGGACCCTGCAGAAGGGGG + Intergenic
1103816045 12:123657376-123657398 CGGTGGGGCCGGACTGAAGAGGG - Intronic
1104151802 12:126091190-126091212 AAGTGGGATGTGACAGAAGAGGG + Intergenic
1104456538 12:128918294-128918316 CACTGGGACCTGTCAGGAGAGGG + Intronic
1109824945 13:67706638-67706660 CACTGGGACCTGTCAGAAGTGGG + Intergenic
1115869156 14:37780406-37780428 CACTGGGGCCTGTCAGAAGAGGG - Intronic
1117647432 14:57866237-57866259 CAGTGGGGCGCGAGAGGAGAAGG + Intronic
1117951091 14:61083186-61083208 CAGTGGGAGCCTACAGAGGGAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1121244038 14:92449872-92449894 CAGTAAGACACGACAGCAGATGG - Intronic
1202835858 14_GL000009v2_random:76951-76973 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1125588642 15:40840343-40840365 CAGTGGGAACAGACAAGAGATGG + Intergenic
1126528040 15:49679666-49679688 CAGTGGCACACCACAGAAGGAGG - Intergenic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1130992020 15:88881308-88881330 CACTGGGACCTGAGAGCAGAGGG - Intronic
1132155088 15:99490156-99490178 CAGTGGGACATAACAAAAGATGG - Intergenic
1133605644 16:7385248-7385270 CAGTGGGGCCCAGGAGAAGAAGG + Intronic
1139243024 16:65413322-65413344 CAGTGGAATCAGACAGAACAAGG - Intergenic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1143378215 17:6479649-6479671 CACTGGGACTCGACAGAATCTGG + Intronic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1148503182 17:48107446-48107468 CAGTGGGTCCCGGGAGCAGAGGG - Intronic
1154317957 18:13320888-13320910 CAGTGGGACCCTCCAGAAGGTGG + Intronic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155981867 18:32188692-32188714 CAAAGGGACTCTACAGAAGAAGG - Intronic
1157009115 18:43625082-43625104 AAGTGGGCTCCGGCAGAAGAAGG - Intergenic
1157138357 18:45081230-45081252 CACAGGGAAACGACAGAAGATGG - Intergenic
1158839194 18:61365308-61365330 CAGTGGGACCCGACAGAAGATGG - Intronic
1161446815 19:4323303-4323325 CAGTGGGACCGGTCAGAAGTGGG - Intronic
1163637464 19:18443997-18444019 CAGTGGCCCCCGACAGCTGAGGG + Exonic
1163757123 19:19112674-19112696 GAGTGGGACCCGGCAGGAGTTGG + Exonic
1166663605 19:44663466-44663488 CAGTGGGACCCCACAGAGTTGGG + Exonic
1166665340 19:44676441-44676463 CAGTGGGAGCAGACAGGAGAGGG - Intronic
1202636779 1_KI270706v1_random:50412-50434 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926883851 2:17578850-17578872 CACAGGGACCTCACAGAAGAGGG + Intronic
927375309 2:22406346-22406368 CAGTGGGAAATGACTGAAGAAGG + Intergenic
931216944 2:60254179-60254201 CAGGGGGACCAGCCAGAAGTTGG - Intergenic
931549947 2:63432316-63432338 TAGTGGGACCCAACAGAAAGTGG - Intronic
931869626 2:66444607-66444629 CAGTGCGGCCCCACAGAAGTGGG + Intronic
931944658 2:67292283-67292305 CACTGGGACCCGTCAGAGGGTGG + Intergenic
935434442 2:103014021-103014043 CACTGGGAGCCCACAGAACAGGG - Intergenic
944875756 2:203962887-203962909 GAGTGTGACTAGACAGAAGATGG + Intergenic
947634838 2:231674765-231674787 CAGTGGCAGCAGACAGAACACGG - Intergenic
947650290 2:231780957-231780979 CAGGTGGGCCCCACAGAAGAAGG - Intronic
948647005 2:239411656-239411678 CAGTAGGACAGGGCAGAAGAGGG + Intergenic
948791440 2:240379463-240379485 CAGAGGGACCAGACACACGAGGG - Intergenic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1171880892 20:30616828-30616850 AAGTGGGACCTGGGAGAAGAGGG + Intergenic
1172697122 20:36830619-36830641 CAGTGGAAACCCAGAGAAGATGG + Intronic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1180364092 22:11923901-11923923 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1183029008 22:35087958-35087980 GAGTGGGACCCCAGAGCAGAGGG - Intergenic
950151667 3:10692423-10692445 CACAGGGACCCGACAGGAGATGG + Intronic
953503374 3:43459603-43459625 CAGTGGGACCCTCCTGAGGAAGG + Intronic
954998287 3:54902075-54902097 CAGTGTGCCCCAACAGCAGATGG + Intronic
957454898 3:80428870-80428892 CACTGGGGCCCATCAGAAGAGGG - Intergenic
961635084 3:128328234-128328256 CAGTGGGCACCCACAGAAGTGGG + Intronic
971523534 4:27586124-27586146 CAATGGCAACCGACAGAACATGG + Intergenic
978082031 4:104605619-104605641 CCCGGGGACCCAACAGAAGAAGG - Intergenic
981734200 4:147932634-147932656 CACTGGGACCTGTCAGAAGGCGG + Intronic
981790472 4:148530605-148530627 CAGTGGGACCTTTCAGAGGAGGG - Intergenic
991975242 5:72178505-72178527 CAGTGGGAGCTGACAGAGCAGGG + Intronic
992299376 5:75362948-75362970 CACTGGAAGCCGAGAGAAGATGG + Intergenic
995633790 5:114162597-114162619 GAGTTGGACCCTACAGAAGCAGG + Intergenic
998924876 5:147111938-147111960 CAGTGGGCTTCGACAGAAAAAGG + Intergenic
1001038554 5:168315537-168315559 CAGTGGGCCCCTACACAAGATGG - Intronic
1001939902 5:175733042-175733064 CAGCGGGACTGGACAGAAAAGGG + Intergenic
1002964429 6:1948952-1948974 CAGTGCCAGCCAACAGAAGATGG - Intronic
1002992410 6:2250059-2250081 CAGTTGGACCAGAAAGCAGAAGG - Intergenic
1004591554 6:17056532-17056554 CACTGGGACGGGACAGAGGAAGG - Intergenic
1005430987 6:25756596-25756618 CAGTGGGAACAGACAGCCGAGGG - Intronic
1006996546 6:38266487-38266509 CACTTGGACCCGAGAGAAGGGGG + Intronic
1009676255 6:66826259-66826281 CAGTGGCTTCAGACAGAAGATGG + Intergenic
1011438632 6:87365018-87365040 CAGTGTGGCCCGACTGATGAGGG + Exonic
1021018418 7:15564873-15564895 CAGGAGGACGAGACAGAAGAGGG - Intergenic
1022887196 7:34658448-34658470 CAGTGGGACCGGGCAGACGCTGG + Exonic
1023570331 7:41565310-41565332 CTGTGGGAAACGACAGGAGAGGG - Intergenic
1024608293 7:51040733-51040755 CAGTGGCACCCCAGAGATGAGGG + Intronic
1028441098 7:90861712-90861734 CACTGGGAGACGAAAGAAGAAGG - Intronic
1034427387 7:151021263-151021285 CAGTTGGACCAGCCAGAAGCCGG + Exonic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1036612173 8:10359884-10359906 CTGTGGGATGCAACAGAAGATGG - Intronic
1037944829 8:22982260-22982282 CAGTGTGTCCCGACAGCAGGTGG - Intronic
1038474630 8:27856537-27856559 AAGTGGGAGCCGACGGGAGAGGG - Intergenic
1040912326 8:52531645-52531667 CATAGGGACCAGACAGAAGAGGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1051370455 9:16355014-16355036 CTGTGGCACCCTACAGTAGAGGG - Intergenic
1051590688 9:18774255-18774277 CAGTGGGAAGCCACTGAAGAGGG - Intronic
1052880610 9:33599162-33599184 AAGCGGGACCCGGGAGAAGAGGG - Intergenic
1055985862 9:82056251-82056273 AAGTGGGACCTGGGAGAAGAGGG - Intergenic
1057675257 9:97132406-97132428 AAGTGGGACCCAGGAGAAGAGGG + Intergenic
1059775579 9:117471455-117471477 CAGTGGGAACCAGCAGATGAGGG + Intergenic
1060283651 9:122229685-122229707 CAGTAGAACCCTAGAGAAGAAGG - Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1192329782 X:70165954-70165976 CTATGGGAACCGACAGAACATGG + Exonic
1200921875 Y:8620467-8620489 CAGTGGGACCCGACACGAAGGGG + Intergenic
1202332456 Y:23769177-23769199 CAGGGGGAAGTGACAGAAGAAGG + Intergenic
1202538313 Y:25900886-25900908 CAGGGGGAAGTGACAGAAGAAGG - Intergenic