ID: 1158841033

View in Genome Browser
Species Human (GRCh38)
Location 18:61387705-61387727
Sequence TGATGTACAGTGCAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158841033 Original CRISPR TGATGTACAGTGCAGTTGGC TGG (reversed) Intronic
901799801 1:11701409-11701431 TGATGTACAGCGCAGTTGAGAGG + Intronic
905298579 1:36970692-36970714 CTATGTACAGTGGAGTGGGCTGG - Intronic
908683598 1:66689824-66689846 TGATGTCCATAGCATTTGGCTGG + Intronic
909258189 1:73451154-73451176 TGATGGAGTGTGCAGTTGGGGGG + Intergenic
916238321 1:162613124-162613146 TGAAGGGCAGTGCATTTGGCAGG + Intergenic
917725928 1:177827273-177827295 TGTGATACAGTGCAGTTTGCAGG - Intergenic
918603203 1:186388795-186388817 GGATGTACAGGGCAGATAGCTGG - Intronic
920967148 1:210710873-210710895 TGCTGTAGAGTGCAGTGGGCTGG - Intronic
924335570 1:242983780-242983802 TCATGTACATGGCTGTTGGCTGG - Intergenic
1065843219 10:29723042-29723064 TTATGTACAGGGCAGTCTGCCGG - Intronic
1068530403 10:58179726-58179748 TGAGTTACAGTGCTGTTGGCTGG + Intergenic
1069127993 10:64661931-64661953 TGAAGTACAGTTCACGTGGCTGG + Intergenic
1072794202 10:98341936-98341958 TGATGGAAATTGCAGGTGGCTGG - Intergenic
1073921325 10:108463228-108463250 TGAAGAACAGAGCAGTGGGCAGG - Intergenic
1075069835 10:119313610-119313632 TGGTGAACAGTGCAGCTGTCAGG + Intronic
1075385047 10:122049445-122049467 TCATGTACACTCCAGTGGGCAGG + Intronic
1077977711 11:7265274-7265296 AGATGTCCAGGGCAGTTGACTGG + Intronic
1087115810 11:94522976-94522998 TGCTGAACAGTGGAGTGGGCAGG - Intergenic
1087891428 11:103542123-103542145 CAATGTCCAGTGCAGTTCGCGGG + Intergenic
1091347908 11:134867510-134867532 GGGTGTACAGTGCAGTCAGCCGG - Intergenic
1091675135 12:2483735-2483757 TGAGGAACAGGGCATTTGGCAGG + Intronic
1093199082 12:16165438-16165460 TCATCTAGAGTTCAGTTGGCAGG - Intergenic
1094051428 12:26224913-26224935 TTAGGGACAGTGCATTTGGCTGG + Intronic
1096559564 12:52425738-52425760 TGATATACAGAGCAGGAGGCTGG + Intronic
1096863293 12:54545900-54545922 TGGTGTTCAATCCAGTTGGCAGG + Exonic
1097726712 12:63083493-63083515 TGATTTATAGTGCACATGGCTGG + Intergenic
1101713605 12:107291024-107291046 TGATGTACAATGCCGTGTGCTGG + Intergenic
1104515856 12:129426044-129426066 CGATCTTCAGTGCAGCTGGCTGG - Intronic
1106121937 13:26867222-26867244 TACTGTACAGTGCTGTTTGCGGG + Intergenic
1106194598 13:27482397-27482419 TGATTTGCAGAGCTGTTGGCTGG - Intergenic
1106858477 13:33878682-33878704 GGATGTTCAGAGCTGTTGGCAGG + Intronic
1106890801 13:34243550-34243572 TAATGAACAGTGCTGCTGGCAGG - Intergenic
1114210024 14:20606352-20606374 CAATGTCCAGTCCAGTTGGCTGG - Intronic
1114334234 14:21671386-21671408 TGATGAAAAGTGCAGTCTGCAGG - Intergenic
1114534962 14:23417029-23417051 TGAGGTCCAGTGGAGTTGGAGGG + Intronic
1118256081 14:64207188-64207210 TGATTTAAAATTCAGTTGGCGGG + Intronic
1119729668 14:76943016-76943038 GGAAGTACAGAGCAGTTGGAAGG - Intergenic
1122916354 14:104860777-104860799 TGATGGACAGTGGAGATGGAGGG - Intergenic
1130315288 15:82790229-82790251 TGATGGCCAGAGGAGTTGGCTGG + Intronic
1136648067 16:31640304-31640326 TGATGTGCAGTGCATGTGGGTGG - Intergenic
1139314425 16:66056306-66056328 TGATGTACAGAGCTGTGGGCAGG - Intergenic
1141669093 16:85482164-85482186 TGATGCCCAGTGCTGTCGGCTGG + Intergenic
1142790815 17:2264217-2264239 TCACGTACATTCCAGTTGGCTGG + Intronic
1147767285 17:42845374-42845396 TGCTGGACAGTCCAGTGGGCAGG - Exonic
1148619128 17:49021542-49021564 TGATGTACAGAGCAGTTATCAGG - Intronic
1149297929 17:55277519-55277541 TGATGTACAGTTCTGTTTTCAGG - Intronic
1203213925 17_KI270730v1_random:105367-105389 TGAAGTAGAGTGCAGTTGAGTGG + Intergenic
1157720957 18:49923957-49923979 TGCTGTACAGTGCAGAGGTCTGG - Intronic
1158841033 18:61387705-61387727 TGATGTACAGTGCAGTTGGCTGG - Intronic
1159275147 18:66209630-66209652 AGATGTACAGTTCAGTGGGCAGG + Intergenic
1159332624 18:67018056-67018078 TGATTTATAGTGCATTGGGCAGG - Intergenic
1159773040 18:72570546-72570568 TGAGTTACAATGCTGTTGGCTGG - Intronic
1162122327 19:8478883-8478905 TGGTGTCCAGTCCAGTTAGCAGG + Intronic
929077714 2:38092278-38092300 TGCTGTGCAGTGCAATTGGGAGG + Intronic
935728498 2:106045165-106045187 GGAAGTACAGTGGAGATGGCGGG - Intergenic
936284950 2:111174662-111174684 TGATGTTCAGTGGAGGTGGGAGG + Intergenic
937826413 2:126372559-126372581 CAATGTCCAGTCCAGTTGGCTGG + Intergenic
940188063 2:151008898-151008920 TGGTGTACAGTTCAGTTTGATGG - Intronic
943385145 2:187194418-187194440 TGAACTACAGTGCAGTTGCAAGG - Intergenic
944546532 2:200804401-200804423 TGATGAACACAGCAATTGGCAGG + Intergenic
945852551 2:215027046-215027068 TGAAATACTATGCAGTTGGCCGG + Intronic
946651622 2:221897674-221897696 TGGTGAACTGTGCATTTGGCAGG - Intergenic
1171253501 20:23668516-23668538 GGATTTACAGGGCAGGTGGCTGG - Intergenic
1172595166 20:36146138-36146160 TGTTTTACATTGCAGTTGGCTGG + Intronic
1176753001 21:10705430-10705452 TGAAATACAGTGCAGTTGAATGG - Intergenic
1180391963 22:12292340-12292362 TCATGTACTGTGTAGATGGCAGG - Intergenic
1180407781 22:12572416-12572438 TCATGTACTGTGTAGATGGCAGG + Intergenic
1182776424 22:32834558-32834580 AGATGTGCAGTGGAGGTGGCAGG + Intronic
951571446 3:24067423-24067445 GGAGGTACAGTGCAGTTGGACGG + Intergenic
952204988 3:31172362-31172384 TGGTGAACTGTGCAGTTGCCTGG - Intergenic
955589140 3:60515226-60515248 TGATGTGGACTGCAGCTGGCAGG + Intronic
958771907 3:98435383-98435405 TGATGTACAGTGATGTGGGAGGG + Intergenic
965366235 3:167803330-167803352 TGATTTACAGTTAAGGTGGCAGG + Intronic
966234328 3:177683973-177683995 TGATGTACGGTGCAGCTGAGAGG - Intergenic
969334950 4:6502353-6502375 TGATGTACGGTGCAGCTGTGTGG + Intronic
969844847 4:9912398-9912420 TGAAGAACTGTGCAGCTGGCAGG + Intronic
970123714 4:12786009-12786031 TGAGTTACAGTGCTGTTGGCTGG + Intergenic
977162553 4:93653367-93653389 TGAGATACACTGGAGTTGGCAGG - Intronic
980576723 4:134692318-134692340 TGATCAACAGTGAAGTTGTCTGG + Intergenic
981358919 4:143825191-143825213 TGCTATACAGTGCTGATGGCAGG - Intergenic
982426552 4:155268929-155268951 TGCTGCACAGAGCACTTGGCTGG - Intergenic
985286416 4:188340686-188340708 TGATGTACTGTGCAGTGAGCAGG + Intergenic
986234808 5:5897397-5897419 ACATGTGCACTGCAGTTGGCAGG - Intergenic
992578362 5:78144443-78144465 TGTTGCACTGTGCAGTGGGCTGG - Intronic
999652544 5:153781577-153781599 TCATGTACATCGAAGTTGGCTGG - Intronic
1000386279 5:160677417-160677439 CTATGAAAAGTGCAGTTGGCTGG - Intronic
1001048559 5:168395254-168395276 TGATGAACAGGGTGGTTGGCAGG + Intronic
1005832081 6:29679575-29679597 TGTTTTGAAGTGCAGTTGGCTGG - Intronic
1009939610 6:70275002-70275024 TGATAAACAATGCAGTTAGCAGG - Intronic
1010173360 6:72998265-72998287 TGATCTTCAGTGCATTTGACAGG - Intronic
1010387002 6:75291597-75291619 TGATTGACAGTGCAGTTTGTGGG + Intergenic
1011879214 6:92002803-92002825 TGATATACATTTCAGTGGGCTGG + Intergenic
1013759967 6:113506617-113506639 CAATGTCCAGTGCAGTTGCCTGG + Intergenic
1013904964 6:115204997-115205019 TGCTGTTCATTGCAGATGGCAGG + Intergenic
1020398530 7:7746727-7746749 TGAGGGACAGGGCATTTGGCTGG - Intronic
1029350292 7:100008690-100008712 TGATGTGCCGTGCTGTGGGCTGG - Intergenic
1029588193 7:101488731-101488753 AGATGGACAGTGGAGATGGCTGG - Intronic
1030406546 7:109121849-109121871 TGCTGTACAGTGAAATTGCCAGG + Intergenic
1031514950 7:122689624-122689646 TCAGGTACAGTCCAATTGGCTGG + Intronic
1032476906 7:132217796-132217818 TGATGGAAAGTGCAGTTGTCTGG + Intronic
1032979892 7:137269386-137269408 TGATCTACAGTGCACTTGTGTGG + Intronic
1033064767 7:138144221-138144243 TGATCTTCTTTGCAGTTGGCTGG - Intergenic
1036390800 8:8322835-8322857 TGATGTACATTGAAGTTGAGGGG - Intronic
1037312933 8:17575763-17575785 CGATGCAGAGAGCAGTTGGCTGG - Intergenic
1041834795 8:62199249-62199271 TCATGTTCACTGCAGTTGGCAGG + Intergenic
1042783340 8:72517789-72517811 TGATGTATAGGGCAGTTTGCAGG + Intergenic
1045327686 8:101128773-101128795 TGATGAACAGCTCAGTAGGCAGG + Intergenic
1046173806 8:110548148-110548170 TGCTGTACAGAGCACTTGGCAGG - Intergenic
1049004416 8:139845690-139845712 AGAGGTACAGTGCAGGTGCCTGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1189303478 X:39969635-39969657 TGATGTTCAGCTCAGTTAGCAGG + Intergenic
1189908121 X:45782739-45782761 TGATTTACAGTGCAGTGGCTGGG + Intergenic
1189980581 X:46506366-46506388 GGATGTGCAGTGCAGCTGTCTGG + Intronic
1191729182 X:64315168-64315190 TGATGGACACTTGAGTTGGCAGG - Intronic
1194465863 X:94234856-94234878 TCATGGACACTGGAGTTGGCTGG + Intergenic
1196806191 X:119588492-119588514 TGATGAAAAGGTCAGTTGGCTGG - Exonic
1197175120 X:123477528-123477550 TGATATACAGTGGAGTTTCCTGG - Intronic
1198475405 X:136992159-136992181 TGATACACAGTGCAGTTGTTTGG - Intergenic
1201097590 Y:10633260-10633282 TGATGTGCAGTGCAGTGGAGTGG - Intergenic
1201098302 Y:10652036-10652058 TGATGTGCAGTGCAGTGGAGTGG - Intergenic
1201110882 Y:10798530-10798552 TGAAGTGCAGTGCAGTTGAATGG - Intergenic
1202389263 Y:24353333-24353355 TCATGTACATGGCTGTTGGCTGG + Intergenic
1202481524 Y:25316791-25316813 TCATGTACATGGCTGTTGGCTGG - Intergenic