ID: 1158842046

View in Genome Browser
Species Human (GRCh38)
Location 18:61397659-61397681
Sequence TGTTCTTAACCACAAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158842046_1158842048 3 Left 1158842046 18:61397659-61397681 CCTCTGTCTTGTGGTTAAGAACA No data
Right 1158842048 18:61397685-61397707 ACTTTGAAGCCAGCCTGCCTGGG No data
1158842046_1158842047 2 Left 1158842046 18:61397659-61397681 CCTCTGTCTTGTGGTTAAGAACA No data
Right 1158842047 18:61397684-61397706 AACTTTGAAGCCAGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158842046 Original CRISPR TGTTCTTAACCACAAGACAG AGG (reversed) Intronic