ID: 1158845108

View in Genome Browser
Species Human (GRCh38)
Location 18:61433743-61433765
Sequence CAAATATAACAGCAAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158845108_1158845111 25 Left 1158845108 18:61433743-61433765 CCTGGTGCTTGCTGTTATATTTG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1158845111 18:61433791-61433813 TGTTTGTGTTGTTCAAGAGCAGG 0: 1
1: 0
2: 2
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158845108 Original CRISPR CAAATATAACAGCAAGCACC AGG (reversed) Intronic
908184127 1:61635254-61635276 CAAATAAAATGGCAAGCAACAGG - Intergenic
913499868 1:119462253-119462275 CAAATATAACATCAAGAAGGTGG - Intergenic
917150188 1:171935082-171935104 CAAATATAAAAGCAAGCCGTAGG - Intronic
919052360 1:192526496-192526518 CAAAAAGAACAGCAAGGGCCGGG - Intergenic
919134751 1:193493631-193493653 CAAATATGACAGCAAGGACTGGG + Intergenic
919826197 1:201505364-201505386 CAATTAAAAGAGCAAACACCTGG + Intronic
1063588798 10:7376869-7376891 CAAACATAAGAGAAAACACCCGG + Intronic
1064384742 10:14879550-14879572 CAGAAATAACACCAAGCTCCCGG - Intronic
1064774574 10:18761418-18761440 CAAATAAAACATCAAGCAGAGGG + Intergenic
1065677298 10:28191144-28191166 CTTACAAAACAGCAAGCACCAGG + Intronic
1068312881 10:55301258-55301280 CAATTATAACAGCAAACACTGGG - Intronic
1068761524 10:60716320-60716342 CATAAATAAAAGCAAGCAACTGG + Intronic
1071745437 10:88413572-88413594 CAAATAGAACAGCGAGCATTTGG - Intronic
1073030315 10:100520317-100520339 CAAATATTTCAGGAAGCCCCTGG - Intronic
1074088123 10:110224185-110224207 CCAAAATAACAGGAAGCTCCTGG - Intronic
1077306786 11:1872150-1872172 CAACTCTACCAGCATGCACCAGG - Intronic
1077306861 11:1872432-1872454 CAACTCTACCAGCACGCACCAGG - Intronic
1084612136 11:70209987-70210009 AAAAAATAAAAGTAAGCACCAGG + Intergenic
1086097152 11:83061910-83061932 CAAATAAAACATAAACCACCTGG + Intronic
1086542064 11:87924929-87924951 CAAATATAAAAGCAGGCTTCAGG - Intergenic
1090496728 11:127220120-127220142 CATTTATAAAAGCAAACACCGGG - Intergenic
1092831145 12:12445612-12445634 AAAATAAAAGAGCAAGTACCAGG - Intronic
1095886903 12:47197907-47197929 CATCTAAAACAGAAAGCACCAGG + Intronic
1100017939 12:90034795-90034817 CAAATATGACATCCAGCACATGG - Intergenic
1100638948 12:96462678-96462700 CAAATGCTACAGCAAGCACTCGG - Intergenic
1104157127 12:126144227-126144249 CAAACATCAAACCAAGCACCGGG - Intergenic
1105753940 13:23447557-23447579 CAAATCTAACTTCAAACACCTGG - Intergenic
1106730780 13:32539401-32539423 CAAGTAGAACAGCGAGCTCCTGG + Intergenic
1109437108 13:62317681-62317703 CCAATATAAAAGTATGCACCCGG - Intergenic
1109919156 13:69032664-69032686 CAAATATATCAACAGGCAACTGG + Intergenic
1117012298 14:51483334-51483356 CACATATACAAGAAAGCACCAGG + Intergenic
1120204896 14:81577352-81577374 CAAATATTGCAGCAAGCATATGG + Intergenic
1120954254 14:90067816-90067838 CAGATATACCAGCAAACACGGGG - Intronic
1121854863 14:97258790-97258812 AATATATAAAAGCAAGCAACAGG + Intergenic
1124905475 15:33864134-33864156 CAAATACATCAGAAAGAACCTGG - Exonic
1125625042 15:41101497-41101519 CAAATATCACAGCAAGTAAGAGG - Intronic
1129823217 15:78618563-78618585 CAAATAAAACAGTCACCACCAGG + Intronic
1131723614 15:95199471-95199493 CAAATAAAAGAGAAAGCATCTGG + Intergenic
1136135213 16:28252344-28252366 CAAAGACAACAGCAAACAGCAGG - Intergenic
1138128198 16:54456198-54456220 CAAACCCAACAGCCAGCACCTGG - Intergenic
1139629732 16:68222526-68222548 CAAATATATAAGCAAGCACCTGG - Intronic
1140020742 16:71236084-71236106 CAAATCTAAGATCAAGCACCAGG + Intergenic
1140379617 16:74474636-74474658 CAAATATAAAGGCAAGCCACTGG + Intronic
1142972534 17:3622552-3622574 GAAATAAAACAAAAAGCACCTGG - Intronic
1143025480 17:3939237-3939259 CAAAGATAAGATCAAGAACCAGG + Intronic
1146810954 17:35902795-35902817 CAAAAAGAATAGCAAGCATCTGG - Intergenic
1147020550 17:37528938-37528960 CAATTATAACGGAAAGCACATGG + Intronic
1149756900 17:59194314-59194336 CAAATATAACAATAGGCTCCAGG - Intronic
1149767024 17:59287758-59287780 AAAATATAACAGGATGCACCTGG + Intergenic
1151130799 17:71894346-71894368 CAAAAAAAAAAGCAAGCAACAGG + Intergenic
1153425936 18:4963301-4963323 CAAACATAAAAGCAAGCAGAAGG - Intergenic
1155690147 18:28610809-28610831 CAATTATTACACCAAGAACCAGG - Intergenic
1156142396 18:34131279-34131301 AAAAACTAACAGAAAGCACCAGG - Intronic
1158845108 18:61433743-61433765 CAAATATAACAGCAAGCACCAGG - Intronic
1162864715 19:13536778-13536800 CAAATTTCACAGGGAGCACCGGG - Intronic
1164860675 19:31559933-31559955 CAGAGATAACAGCAAGTGCCAGG - Intergenic
1166264336 19:41668753-41668775 AAAAAATAACATCAAGCTCCAGG - Intronic
1168435438 19:56313691-56313713 AAAAACTAACATCAAGCACCTGG - Intronic
925408732 2:3626527-3626549 GAATAATAACAGCAACCACCAGG - Intronic
926643732 2:15265806-15265828 TAAAGATAAAAGCAGGCACCAGG + Intronic
927544963 2:23944309-23944331 CAAATAACACAGTAAGAACCAGG - Intronic
929308813 2:40398384-40398406 CAAATATACCACCAATAACCAGG - Intronic
931072197 2:58665155-58665177 CTAATATAACAGAAATGACCAGG - Intergenic
933383672 2:81583495-81583517 CAGATATGAGAGCATGCACCGGG - Intergenic
935524836 2:104152907-104152929 TAAATACAACAGGAAGCAACTGG + Intergenic
935623748 2:105151388-105151410 CAAATAAAATTTCAAGCACCAGG - Intergenic
935898700 2:107766929-107766951 CAAAAATAACAAATAGCACCAGG + Intergenic
937245956 2:120493453-120493475 AAAATGCAACAGGAAGCACCTGG - Intergenic
937500152 2:122469709-122469731 CAAATGCAACAGTAAGCAGCTGG + Intergenic
939103455 2:137922679-137922701 TAAATACAAAAGCAAGCACAAGG - Intergenic
939871001 2:147525835-147525857 CAAAGAAAACAAAAAGCACCTGG + Intergenic
940606559 2:155930968-155930990 CAAATAAAACCACAAGCTCCTGG + Intergenic
940628160 2:156202852-156202874 CACATATCACACCAAGAACCAGG - Intergenic
941785604 2:169495375-169495397 CAAAAAGAACAGAAAGCACAAGG - Intronic
944131451 2:196351922-196351944 CAAATTTACCAGCAAGTACCAGG + Intronic
944812647 2:203343100-203343122 CAAAACTAAAAGCAAGCACCTGG + Intronic
946978011 2:225174835-225174857 CAAATATAAAAGCAGGAGCCAGG + Intergenic
947155868 2:227162990-227163012 CAAATTTAACTGCAAGCAAGTGG + Intronic
947662075 2:231877266-231877288 CAGTTATAGCAGGAAGCACCAGG - Intergenic
948043437 2:234923576-234923598 AAAATATAACAGCAAGATTCTGG + Intergenic
948438453 2:237969403-237969425 CCCACAGAACAGCAAGCACCAGG - Intronic
948737511 2:240018860-240018882 CAGCTATAACAGAAAGCATCCGG + Intronic
948865866 2:240774419-240774441 CACAGACAACAGCAAGGACCTGG + Intronic
1169915066 20:10675108-10675130 CAAATGCAACAGCAAGCCCGTGG - Intergenic
1173658478 20:44717050-44717072 CAGATATCACAGCAAGGCCCTGG + Intronic
1174375950 20:50126854-50126876 CAAAGGTAACAGGAAGCAGCAGG - Intronic
1178233807 21:30818974-30818996 TAATTATCACAGCAAGCATCTGG + Intergenic
951043925 3:18017505-18017527 CTGATATAACATCCAGCACCTGG - Intronic
951960985 3:28320170-28320192 CCAATATAAGAGCATGTACCAGG - Exonic
952862265 3:37822814-37822836 CAGACATAACTGCATGCACCTGG - Exonic
952994597 3:38867016-38867038 CTAATAGAACAACAACCACCAGG - Intronic
954921305 3:54193486-54193508 AAAATATTTTAGCAAGCACCTGG - Intronic
955134980 3:56208519-56208541 CAGATTTAACAGCAAACACAAGG + Intronic
955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG + Intergenic
955633644 3:61002260-61002282 CAAAAATAAAAGCAAAAACCAGG - Intronic
957273542 3:78061935-78061957 CTAAAATAACAGCAAGCATATGG + Intergenic
957454581 3:80424328-80424350 GAAATGTAACAGAAAGAACCAGG - Intergenic
958102984 3:89037149-89037171 CAAACATGACAGAAAGCACTGGG + Intergenic
960798245 3:121511482-121511504 CAAAAAAAACATAAAGCACCGGG + Intronic
961661592 3:128471578-128471600 CAAAGGGAACAGCATGCACCAGG + Intergenic
962189218 3:133292467-133292489 CAAAGCTAACAGCAAGCAAGAGG - Intronic
964451845 3:156820907-156820929 CAAATATAAGAGGAAGCACTTGG - Intergenic
967680648 3:192358972-192358994 CAAATATAGATGCAAGAACCAGG - Intronic
968291849 3:197545149-197545171 CAAATATAACAGAAAGAAAAAGG + Intronic
972287783 4:37665325-37665347 TAAATATACCAGCATGCTCCTGG + Intronic
972320287 4:37967065-37967087 CGAATTGCACAGCAAGCACCTGG - Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
975371796 4:73597690-73597712 TATTTATAACAGCAAGCACATGG + Intronic
976894541 4:90092728-90092750 TGAATATAACACCAAGCACATGG - Intergenic
977266068 4:94856393-94856415 CATAGAAAACAGCAAGAACCTGG + Intronic
978534529 4:109747061-109747083 CAGATATAATAGTAGGCACCAGG - Intronic
978704043 4:111683817-111683839 GAATTATAACAGCAAGCTTCTGG - Intergenic
979570512 4:122218262-122218284 CAAATATAACAGAAAACACTGGG - Intronic
980684904 4:136214642-136214664 AGAATATAACAACAAACACCAGG - Intergenic
981819936 4:148874767-148874789 CAAATCTAACAGAAAGCCACAGG + Intergenic
982572133 4:157063686-157063708 TAAATATCCCATCAAGCACCTGG + Intergenic
983907658 4:173201403-173201425 CAAAGAGAACAGCAAGTACTTGG - Intronic
997947036 5:138212076-138212098 GAAATATAGATGCAAGCACCAGG + Intronic
999631208 5:153573212-153573234 AAAATATAAAAGCCAGTACCAGG - Intronic
1005943518 6:30579093-30579115 CAAGTAGAAGAGCAAGGACCTGG - Intronic
1010765484 6:79773865-79773887 CAAATACAATAGCAAGCAGTAGG + Intergenic
1011194897 6:84771339-84771361 AAAATAAATCAGCAAGCACTTGG - Intergenic
1011781141 6:90790638-90790660 AAAATATACCAGCAAGTATCAGG + Intergenic
1012237018 6:96830690-96830712 CAAATATAACTGCATTCACTTGG + Intronic
1015817432 6:137224959-137224981 CCAATATAACACTAAACACCAGG + Intergenic
1016694549 6:146977413-146977435 CAAATATAAAATCAAGCATTGGG + Intergenic
1016987234 6:149904724-149904746 CAAATTTACCACCAAGCTCCTGG - Intergenic
1017096530 6:150810136-150810158 AAAATATAAAAGTTAGCACCCGG + Intronic
1017147714 6:151249823-151249845 CAATTATAATAGCAAGCCCATGG + Intronic
1017995709 6:159530101-159530123 TAAATATAACTGCAAACACTTGG - Intergenic
1023230347 7:38021371-38021393 CTAAGATACCAGCAAGCACAGGG - Intronic
1026090042 7:67292150-67292172 TAAAGATATCAGTAAGCACCAGG - Intergenic
1028505278 7:91563572-91563594 TAAATATAAAAGCAGCCACCTGG - Intergenic
1029309950 7:99653802-99653824 CAAATATAACACCAAGTGCTAGG - Intronic
1029315583 7:99710193-99710215 CAAATATAACACTAAGTACTAGG - Intronic
1029321309 7:99762984-99763006 CAAATATAACACCAAATACTAGG - Intronic
1029782666 7:102750123-102750145 GAAATATAACAGTAAGAAGCTGG - Intronic
1031405737 7:121384548-121384570 GAAATAGAACATCAAGTACCTGG - Intronic
1032143997 7:129362088-129362110 CATATAAAACACTAAGCACCAGG - Intronic
1032304719 7:130721976-130721998 CAAAAACAACAAAAAGCACCAGG - Intergenic
1032780598 7:135162404-135162426 CTAATACAACAGCATTCACCAGG - Intronic
1033221092 7:139526468-139526490 CAAATACAAAAGCCAGCACTGGG - Intronic
1033605620 7:142926214-142926236 TAAATATAACAGAAAGCAACTGG + Intronic
1034477882 7:151298192-151298214 GAAATCAAACAGCAAGCATCTGG - Intergenic
1036030742 8:4969091-4969113 AAATTATAAAAGCAACCACCAGG - Intronic
1037267797 8:17085769-17085791 CAAAGATAACAGAAAGGAACAGG - Intronic
1037310304 8:17548822-17548844 AAAATATATCAGCAAGTGCCAGG + Exonic
1038868036 8:31461073-31461095 CAGAAAGAAAAGCAAGCACCTGG + Intergenic
1041279035 8:56192988-56193010 GAAATATAACAGCTAACAGCAGG + Intronic
1042988742 8:74614405-74614427 CAATTATAAAAGCAAGGACCAGG - Intronic
1045404781 8:101854965-101854987 CAAATATAGCAGCAAGGGCAGGG + Intronic
1049144986 8:140993348-140993370 CAAACAAAACAGTAAACACCTGG + Intronic
1049248798 8:141577236-141577258 CAAAGAAAGCAGCAACCACCTGG - Intergenic
1051692544 9:19731755-19731777 CAAATATAATACCAAGTACAGGG + Intronic
1053478332 9:38397786-38397808 CAACTAAAACAGCCAGCAACTGG - Exonic
1055285914 9:74727676-74727698 CTACTATAAAAGCAAGCAGCTGG - Intronic
1055764272 9:79644722-79644744 GAAATAGAGCAGCAAGCACAGGG - Intronic
1056294896 9:85182819-85182841 AAAACATAGCAGCAAACACCAGG + Intergenic
1056848383 9:90059652-90059674 CAAATCTGATAGCAGGCACCTGG + Intergenic
1057713632 9:97469604-97469626 CAAACAAAACAACAAACACCAGG - Intronic
1061625384 9:131838205-131838227 CGAATAAAACAGCGACCACCAGG - Intergenic
1062652450 9:137585070-137585092 CTAATATTAGAGCAAGGACCGGG + Intronic
1185569283 X:1120964-1120986 CAAAAATAAAAGCAAAAACCTGG - Intergenic
1195586646 X:106572721-106572743 CATCTAAAACAGAAAGCACCAGG + Intergenic
1196010176 X:110878419-110878441 CAAATATCACATCAAGGAGCAGG - Intergenic
1196038943 X:111180056-111180078 CAATTAAAAAAGCAAGCATCTGG - Intronic
1197160228 X:123314444-123314466 TAAAAATAACAGAAAGCAACTGG - Intronic
1198552670 X:137761094-137761116 AAAATCTAACAGCCAGCTCCAGG + Intergenic
1199719375 X:150531404-150531426 CACAGAAAACAGCAAGCACTAGG - Intergenic
1200407480 Y:2828072-2828094 CAAAGATGACAGCAAGAACCAGG - Intergenic
1201181492 Y:11352028-11352050 TAAATATAACAGGCAGCACATGG + Intergenic