ID: 1158845649

View in Genome Browser
Species Human (GRCh38)
Location 18:61439930-61439952
Sequence ACTAGCATATTAATTGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158845647_1158845649 25 Left 1158845647 18:61439882-61439904 CCTATTTCAAAGAATTTATGTTT 0: 1
1: 0
2: 0
3: 63
4: 810
Right 1158845649 18:61439930-61439952 ACTAGCATATTAATTGTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158845649 Original CRISPR ACTAGCATATTAATTGTTAC AGG Intronic
900526533 1:3131918-3131940 ACTAGCATTTTAAGTATTATGGG - Intronic
905859542 1:41340987-41341009 ATTAGCATCTGAATTCTTACAGG - Intergenic
912232638 1:107813400-107813422 ACTGGCATATTAGTTATTATAGG + Intronic
913339226 1:117741070-117741092 ACTATCATATTCATTTTTACAGG - Intergenic
913974454 1:143443701-143443723 ACTAGGGTGTTTATTGTTACTGG - Intergenic
914068844 1:144269315-144269337 ACTAGGGTGTTTATTGTTACTGG - Intergenic
914110311 1:144697039-144697061 ACTAGGGTGTTTATTGTTACTGG + Intergenic
915192733 1:154165474-154165496 ACTTGCATATTCATTTTTATTGG - Intronic
917776839 1:178346518-178346540 AATAGCGTATTTATTGTTTCAGG - Intronic
918183053 1:182101765-182101787 ACAAGCATATTATGTGTTAATGG + Intergenic
919208999 1:194455345-194455367 ACTAGCTTGTTACTTTTTACAGG - Intergenic
921017893 1:211208944-211208966 ATTATTATATTAAATGTTACTGG + Intergenic
921094094 1:211872298-211872320 ACTAGAAAATTAATTTTAACCGG - Intergenic
924010257 1:239657163-239657185 GTTAGCATATAAAATGTTACTGG - Intronic
1065849597 10:29776453-29776475 ACTTGCATATTCATTGGTAAGGG + Intergenic
1068018087 10:51543371-51543393 AACAGCATATTAATTGACACAGG + Intronic
1069172977 10:65255649-65255671 ACTATCTCATTACTTGTTACCGG - Intergenic
1076449612 10:130547650-130547672 ACTGGTATAGTAATTGTGACTGG + Intergenic
1078252332 11:9626481-9626503 ACTAGAATATAAACTGTTCCTGG - Intergenic
1079799931 11:24855984-24856006 CCTAGGATTTTAATAGTTACAGG - Intronic
1080850198 11:36061889-36061911 GTTTGCATATTAATTGTTACTGG + Intronic
1086127044 11:83359627-83359649 TAAAGCATATTAAATGTTACAGG + Intergenic
1086579827 11:88386324-88386346 ACCAGCATAATAATTGATCCAGG - Intergenic
1087336935 11:96855568-96855590 ACTAGCATTGTTATTGTTAATGG - Intergenic
1087377536 11:97363628-97363650 ACTAGCAAATTAGGTGTTAATGG + Intergenic
1093680070 12:21992408-21992430 ACTATCATATTAGTTGATGCTGG + Intergenic
1097615724 12:61881463-61881485 AATAGCATATTAAATCTTATGGG + Intronic
1098267227 12:68734386-68734408 ACTAGCCTATTAGTTTTTAGAGG - Intronic
1104413032 12:128575124-128575146 ACCAGCATTTACATTGTTACAGG + Intronic
1105613852 13:21994574-21994596 ACTGGCTTATTAAATTTTACAGG + Intergenic
1109033298 13:57221601-57221623 AAAAGCATATTAATTGTTTATGG + Intergenic
1110625355 13:77649613-77649635 ATTCTCATATTCATTGTTACAGG + Intergenic
1110869074 13:80429672-80429694 AATTGCATATTTTTTGTTACCGG + Intergenic
1111578218 13:90187184-90187206 ACTAGAATTTTAATTGACACTGG - Intergenic
1120533373 14:85661699-85661721 TATTGCATATTAATTGTGACAGG - Intergenic
1121750929 14:96355611-96355633 ACCAACATATTAATAGTTCCTGG + Intronic
1121959905 14:98249666-98249688 ACAAGCATTTTAATTGCAACGGG - Intergenic
1123875372 15:24618537-24618559 ACTAATATAAAAATTGTTACTGG - Intergenic
1129547805 15:76416856-76416878 ACTTGCAAATTAATTTCTACTGG - Intronic
1130158342 15:81373381-81373403 ATAAGCATATTAAGTGTAACTGG - Intronic
1138754977 16:59473152-59473174 AGTTGCATATTGATTCTTACTGG + Intergenic
1144113784 17:12065732-12065754 ACTATAATTTTTATTGTTACTGG - Intronic
1146022349 17:29290777-29290799 GTTAGCATATTAAATGATACAGG - Intronic
1146152132 17:30483093-30483115 ACTAGAATATTATTTATTCCAGG + Intronic
1153034931 18:752571-752593 ACTAGTAAATTAGTTATTACTGG - Intronic
1153295122 18:3538026-3538048 ACTAGAATATTAGTTTTTATTGG - Intronic
1154183137 18:12155208-12155230 ACTAGAATAAAAATTGTTATGGG - Intergenic
1155820329 18:30367527-30367549 ATTAGCATAATAATTGTGTCTGG + Intergenic
1156590927 18:38487330-38487352 ACTACCATATTTATTTTTTCTGG + Intergenic
1156742699 18:40351726-40351748 AATAGAATATAAATTGTTAAAGG + Intergenic
1158024444 18:52879108-52879130 AATACTATATTACTTGTTACTGG + Intronic
1158845649 18:61439930-61439952 ACTAGCATATTAATTGTTACAGG + Intronic
1159343895 18:67173288-67173310 GCTAGCATGTTAATTGTGGCAGG + Intergenic
1164745960 19:30613345-30613367 ATCATCATAATAATTGTTACAGG - Intronic
1168560385 19:57377106-57377128 ACCAGCATTTTTATTCTTACAGG + Exonic
932093227 2:68825074-68825096 GCTAGGATTTTAATCGTTACTGG - Intronic
932743981 2:74316231-74316253 ACAATCATTTTAATTGTTATTGG - Intronic
934179160 2:89604676-89604698 ACTAGGGTGTTTATTGTTACTGG - Intergenic
934289444 2:91678944-91678966 ACTAGGGTGTTTATTGTTACTGG - Intergenic
935470245 2:103450650-103450672 ATTAAAATATAAATTGTTACTGG - Intergenic
936735455 2:115436888-115436910 GCTAGAATATTAATTATTATTGG - Intronic
937503092 2:122504469-122504491 ACAAGCATATTAACTTTTTCTGG - Intergenic
938793437 2:134697331-134697353 CCTAAAATATTAATTGTAACTGG - Intronic
939047977 2:137272087-137272109 ACTAATATATTAATTATTATAGG + Intronic
941576486 2:167239051-167239073 ACTAGCATAATAATTTATATTGG + Intronic
941922007 2:170860423-170860445 AGTAGCAGAGTCATTGTTACAGG + Exonic
944357837 2:198813139-198813161 ACCATCATATTCATTGTAACTGG - Intergenic
944491091 2:200258551-200258573 AGTACCATATTAATTTCTACTGG - Intergenic
944981966 2:205131580-205131602 ATGAGCAAATAAATTGTTACAGG + Intronic
946580856 2:221127162-221127184 ACTAGTAAATAAATTGATACCGG + Intergenic
947286510 2:228522668-228522690 AATAGCATGTTAATTATTAAAGG + Intergenic
1170007034 20:11680693-11680715 GCTACCATATTGATTGTTACTGG + Intergenic
1176931544 21:14817595-14817617 ACTAGTAAATTAATGGTTTCTGG - Intergenic
1178073047 21:28990550-28990572 ACTAACATATTATTTGTTATTGG + Intronic
1178234369 21:30824228-30824250 ACTTGCATAATAATTTTTAGAGG - Intergenic
1178259347 21:31084424-31084446 ATCACCATATTAATTATTACAGG - Intergenic
1184200536 22:42965826-42965848 ATTATCATATTAAATTTTACTGG - Intronic
952604581 3:35129641-35129663 ACTTGCATATTAATGTTTATAGG + Intergenic
955562497 3:60206870-60206892 ACTAGAATAGTAATTGCAACTGG - Intronic
958534781 3:95386467-95386489 ACAAGCATATTATTTGTTGTTGG + Intergenic
959486923 3:106937336-106937358 ACCATCATATAAATTTTTACAGG + Intergenic
959982456 3:112530459-112530481 ACTACAATAATAATTGTTTCAGG + Intergenic
960232086 3:115240134-115240156 ACTAGAATATAAAGTGTTTCCGG - Intergenic
960818611 3:121701952-121701974 ACTAGCATATTATCTTTTTCAGG - Intronic
964192444 3:154019178-154019200 ACTATAATATTAATTATTAGGGG - Intergenic
970982580 4:22118088-22118110 ACCAGCATATTAATGATTTCTGG - Intergenic
981605478 4:146535995-146536017 AGTAGCATATTCATAGGTACTGG + Intergenic
984038629 4:174701241-174701263 TTTAGCATAATAATTGTTAAGGG - Intronic
985232073 4:187829636-187829658 TCTAGCATCTTAACTGTGACAGG - Intergenic
986961802 5:13221944-13221966 AGTAACATATTAATATTTACAGG - Intergenic
987544291 5:19292587-19292609 ACTAGAAAAAAAATTGTTACTGG + Intergenic
987676748 5:21084506-21084528 ACTACCATATTAATTGATTATGG - Intergenic
990964675 5:61432425-61432447 CCTTGCATATTAATTGAAACTGG + Intronic
994962219 5:106620261-106620283 TCAAGCATTTTCATTGTTACTGG + Intergenic
995813282 5:116134524-116134546 ACCATCATATTTATTGTTCCAGG - Intronic
996605540 5:125316937-125316959 AGTATTATATTAATTTTTACAGG + Intergenic
997286682 5:132684619-132684641 AATAGAATATTGATTGCTACAGG + Intergenic
999066452 5:148691959-148691981 TCTAGGATATTTATTGTTTCGGG - Intergenic
999413602 5:151375170-151375192 TCTAGCATTTTAATAGTTTCAGG + Intergenic
999524318 5:152386211-152386233 ACCAGCATATTAATAGCTAGTGG + Intergenic
1000368531 5:160512800-160512822 ACTAGGATAGTAATTGTGAAAGG - Intergenic
1003285658 6:4731846-4731868 TCTTGCATATTAATTTTTGCAGG - Intronic
1009531671 6:64825300-64825322 ACAAGGAGATTACTTGTTACAGG - Intronic
1011091257 6:83603091-83603113 ACCAGCATAGTACTTGTCACAGG + Intronic
1013821262 6:114155914-114155936 ACTAGCTTATTCATTTCTACAGG - Intronic
1014176884 6:118341158-118341180 ACTAGTATACTAAATGTGACGGG - Intergenic
1016771816 6:147860423-147860445 ACTAAGATATTAGTTGTTATGGG - Intergenic
1017401624 6:154070950-154070972 ATTAAAATATTAATTGTTAAAGG - Intronic
1018218642 6:161556386-161556408 ACTAGCACATTCTTTGTTCCAGG - Intronic
1020664844 7:11027011-11027033 ACTAGCATTTTAAATGATTCAGG + Intronic
1027835761 7:83239490-83239512 ACTACTATTTTAATTGTAACTGG + Intergenic
1028032209 7:85930533-85930555 ACGAGCATATTTATTGAGACTGG + Intergenic
1030005580 7:105115727-105115749 ACTAGATTATGAATTTTTACAGG - Intronic
1031222203 7:118982603-118982625 ACTCACATATTTATTGTTTCTGG - Intergenic
1032654360 7:133911468-133911490 ACTAACATATTTATTGTTGAGGG + Intronic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1038918661 8:32056540-32056562 ACTCCCATATTATTTTTTACTGG + Intronic
1042097806 8:65237231-65237253 AGTATCATTTTAATTATTACGGG - Intergenic
1042716520 8:71779071-71779093 AGTAGCAGAATAATTGTTCCAGG - Intergenic
1042974109 8:74445983-74446005 ACTAGCATATTTCTTGTAAAGGG - Intronic
1043619674 8:82173847-82173869 AGTAGCATATTAATTGCTCAAGG - Intergenic
1044441116 8:92225149-92225171 ACTAGCATTTGGAATGTTACTGG - Intergenic
1045429979 8:102104719-102104741 ACTAACATGTCAATTGTCACGGG + Intronic
1046256928 8:111712262-111712284 AATAGAATATTAATTATTCCAGG - Intergenic
1046343725 8:112893920-112893942 ACTATCATAATAATTTTTAAAGG + Intronic
1047372040 8:124264163-124264185 AATAGAATAGTAATTGTTAGGGG - Intergenic
1047962271 8:130019125-130019147 CCTACCATAATAATTGTTAAAGG + Intergenic
1048402565 8:134085697-134085719 AATATCATTTTTATTGTTACTGG - Intergenic
1050199032 9:3121724-3121746 CCTAGCATTTTAATTGTTGAAGG - Intergenic
1055525284 9:77127392-77127414 ACTATCAGAATATTTGTTACTGG + Intergenic
1055844238 9:80541858-80541880 ACTAGCATTTTAATTTGCACAGG - Intergenic
1059618589 9:115978038-115978060 ATAATCAAATTAATTGTTACAGG - Intergenic
1060773672 9:126351929-126351951 ATGATCATATTAATTGATACAGG - Intronic
1188508507 X:30909046-30909068 ACTGGCATATTTATAGTCACAGG + Intronic
1188775262 X:34209213-34209235 ACCACAATAATAATTGTTACAGG - Intergenic
1189695922 X:43662055-43662077 CCTAGCAGAATAATTTTTACAGG - Intronic
1191075239 X:56445816-56445838 TCTAGCATGTTATTTGTTTCAGG + Intergenic
1191627100 X:63281240-63281262 GCTAGCATAGTAATTGTAAGAGG - Intergenic
1193596904 X:83457833-83457855 TCTAGCATATTTATGGTTTCAGG - Intergenic
1193651609 X:84141147-84141169 ACTTGCATAGTCATTTTTACTGG - Intronic
1194020691 X:88688407-88688429 ACTTGCCTCTTAATTGTTTCTGG + Intergenic
1194793458 X:98180252-98180274 ACTAGCATTTTAATTATAACAGG + Intergenic
1195564096 X:106322236-106322258 ACTAACATATTAACAGTGACTGG + Intergenic
1196892917 X:120308160-120308182 ATAAGTATATTAATTGTAACTGG + Intronic
1199367085 X:146999967-146999989 TCTAGTATAGTAATTGTCACTGG - Intergenic
1199655717 X:149993529-149993551 AAAAGCATATTAATTGTAGCTGG + Intergenic
1199860131 X:151793978-151794000 ACTAGCAAATAAAATGTGACTGG - Intergenic
1200941861 Y:8791322-8791344 ACTTGCATAATAATTGTTAATGG - Intergenic