ID: 1158845763

View in Genome Browser
Species Human (GRCh38)
Location 18:61441109-61441131
Sequence CTTCAAAAACTGATTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158845763 Original CRISPR CTTCAAAAACTGATTGATCA TGG Intronic
906587064 1:46988073-46988095 CTTCAAAAATTGATGAATCCAGG + Intergenic
909291789 1:73892080-73892102 CTCCAAAAAAAAATTGATCATGG - Intergenic
910099077 1:83557303-83557325 ATTCAAGAACTGATTGATGTTGG + Intergenic
912850299 1:113118274-113118296 CTTTGAAAACTGAATGATGAAGG - Intronic
913046087 1:115074526-115074548 TTTCAGAAGCTGATTGATCCCGG - Intronic
913605727 1:120463942-120463964 CTTCAAAAACTGTATTCTCATGG + Intergenic
913643144 1:120831564-120831586 CTTCAAAAACTGTATTCTCATGG + Intronic
913643911 1:120838317-120838339 CTTCAAAAACTGTATTCTCATGG + Intronic
914082821 1:144425280-144425302 CTTCAAAAACTGTATTCTCATGG - Intronic
914177737 1:145293784-145293806 CTTCAAAAACTGTATTCTCATGG - Intronic
914178282 1:145298550-145298572 CTTCAAAAACTGTATTCTCATGG - Intronic
914178827 1:145303296-145303318 CTTCAAAAACTGTATTCTCATGG - Intronic
914179205 1:145306479-145306501 CTTCAAAAACTGTATTCTCATGG - Intronic
914179580 1:145309660-145309682 CTTCAAAAACTGTATTCTCATGG - Intronic
914180125 1:145314428-145314450 CTTCAAAAACTGTATTCTCATGG - Intronic
914180670 1:145319198-145319220 CTTCAAAAACTGTATTCTCATGG - Intronic
914181213 1:145323948-145323970 CTTCAAAAACTGTATTCTCATGG - Intronic
914181756 1:145328708-145328730 CTTCAAAAACTGTATTCTCATGG - Intronic
914182301 1:145333461-145333483 CTTCAAAAACTGTATTCTCATGG - Intronic
914182846 1:145338217-145338239 CTTCAAAAACTGTATTCTCATGG - Intronic
914183391 1:145342971-145342993 CTTCAAAAACTGTATTCTCATGG - Intronic
914183935 1:145347741-145347763 CTTCAAAAACTGTATTCTCATGG - Intronic
914184479 1:145352505-145352527 CTTCAAAAACTGTATTCTCATGG - Intronic
914185023 1:145357253-145357275 CTTCAAAAACTGTATTCTCATGG - Intronic
914185568 1:145362006-145362028 CTTCAAAAACTGTATTCTCATGG - Intronic
914186114 1:145366766-145366788 CTTCAAAAACTGTATTCTCATGG - Intronic
914186660 1:145371514-145371536 CTTCAAAAACTGTATTCTCATGG - Intronic
914187204 1:145376268-145376290 CTTCAAAAACTGTATTCTCATGG - Intronic
914187747 1:145381020-145381042 CTTCAAAAACTGTATTCTCATGG - Intronic
914188292 1:145385776-145385798 CTTCAAAAACTGTATTCTCATGG - Intronic
914188835 1:145390532-145390554 CTTCAAAAACTGTATTCTCATGG - Intronic
914210691 1:145576223-145576245 CTTCAAAAACTGTATTCTCATGG - Intergenic
914269987 1:146071731-146071753 CTTCAAAAACTGTATTCTCATGG - Intronic
914270528 1:146076469-146076491 CTTCAAAAACTGTATTCTCATGG - Intronic
914271064 1:146081199-146081221 CTTCAAAAACTGTATTCTCATGG - Intronic
914272137 1:146090644-146090666 CTTCAAAAACTGTATTCTCATGG - Intronic
914272673 1:146095366-146095388 CTTCAAAAACTGTATTCTCATGG - Intronic
914273211 1:146100088-146100110 CTTCAAAAACTGTATTCTCATGG - Intronic
914273750 1:146104806-146104828 CTTCAAAAACTGTATTCTCATGG - Intronic
914274288 1:146109514-146109536 CTTCAAAAACTGTATTCTCATGG - Intronic
914274824 1:146114232-146114254 CTTCAAAAACTGTATTCTCATGG - Intronic
914275358 1:146118958-146118980 CTTCAAAAACTGTATTCTCATGG - Intronic
914275893 1:146123690-146123712 CTTCAAAAACTGTATTCTCATGG - Intronic
914366939 1:146987500-146987522 CTTCAAAAACTGTATTCTCATGG + Intronic
914367475 1:146992261-146992283 CTTCAAAAACTGTATTCTCATGG + Intronic
914485509 1:148105944-148105966 CTTCAAAAACTGTATTCTCATGG - Intronic
914532826 1:148538412-148538434 CTTCAAAAACTGTATTCTCATGG - Intronic
914533360 1:148543126-148543148 CTTCAAAAACTGTATTCTCATGG - Intronic
914533895 1:148547834-148547856 CTTCAAAAACTGTATTCTCATGG - Intronic
914534431 1:148552542-148552564 CTTCAAAAACTGTATTCTCATGG - Intronic
914534967 1:148557254-148557276 CTTCAAAAACTGTATTCTCATGG - Intronic
914535502 1:148561999-148562021 CTTCAAAAACTGTATTCTCATGG - Intronic
914536573 1:148571445-148571467 CTTCAAAAACTGTATTCTCATGG - Intronic
914536934 1:148574641-148574663 CTTCAAAAACTGTATTCTCATGG - Intronic
914585479 1:149057927-149057949 CTTCAAAAACTGTATTCTCATGG - Intronic
914628989 1:149490709-149490731 CTTCAAAAACTGTATTCTCATGG + Intergenic
914629522 1:149495466-149495488 CTTCAAAAACTGTATTCTCATGG + Intergenic
914630057 1:149500221-149500243 CTTCAAAAACTGTATTCTCATGG + Intergenic
914630591 1:149504982-149505004 CTTCAAAAACTGTATTCTCATGG + Intergenic
914631124 1:149509743-149509765 CTTCAAAAACTGTATTCTCATGG + Intergenic
914631656 1:149514504-149514526 CTTCAAAAACTGTATTCTCATGG + Intergenic
914632192 1:149519258-149519280 CTTCAAAAACTGTATTCTCATGG + Intergenic
914632729 1:149524013-149524035 CTTCAAAAACTGTATTCTCATGG + Intergenic
914633263 1:149528762-149528784 CTTCAAAAACTGTATTCTCATGG + Intergenic
914633799 1:149533493-149533515 CTTCAAAAACTGTATTCTCATGG + Intergenic
914634335 1:149538248-149538270 CTTCAAAAACTGTATTCTCATGG + Intergenic
914634869 1:149543001-149543023 CTTCAAAAACTGTATTCTCATGG + Intergenic
914635404 1:149547738-149547760 CTTCAAAAACTGTATTCTCATGG + Intergenic
914635939 1:149552475-149552497 CTTCAAAAACTGTATTCTCATGG + Intergenic
918285419 1:183050068-183050090 CTTTGAAATCTGATTGATAAAGG - Intronic
919563520 1:199155037-199155059 CTTCAAGAACTTATTGAGAACGG - Intergenic
921551921 1:216547331-216547353 CTTCAAAAACTGCATGAGGAAGG - Intronic
923351542 1:233112128-233112150 CTTCCAAAACTGCTAGTTCAAGG + Intronic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
1066604670 10:37150975-37150997 CTTCTAAAAATGAGTGAACATGG + Intronic
1066605495 10:37164011-37164033 CTTCTAAAAATGAGTGAACATGG + Intronic
1066606206 10:37175073-37175095 CTTCTAAAAATGAGTGAACATGG + Intronic
1066606990 10:37186874-37186896 CTTCTAAAAATGAGTGAACATGG + Intronic
1067734989 10:48843889-48843911 TTTCAAAAACATATTCATCAAGG + Intronic
1070365166 10:75729686-75729708 CTTCAAATCATGATTGAACAAGG + Intronic
1070499495 10:77057712-77057734 TTTAAAAAATTGATTGCTCATGG - Intronic
1079272540 11:19002003-19002025 CTTCAAAAAATTACTGCTCATGG + Intergenic
1079892377 11:26072598-26072620 TTTCAAAAAATGAGTGATGAGGG - Intergenic
1080597568 11:33788028-33788050 CTTCAAAAACTGAGTGATATGGG - Intergenic
1081521339 11:43884659-43884681 CATAACAAACAGATTGATCATGG - Intronic
1083732696 11:64661306-64661328 CTGCAAAAACTGCTTGACAAAGG + Intronic
1084036135 11:66511608-66511630 CTTCAAAAATTGACAGCTCATGG - Intronic
1084887025 11:72217419-72217441 CTCCAAAAACTTACTGACCATGG - Intronic
1088367005 11:109050364-109050386 CTTCAAAGACGGCTTGATCCAGG + Intergenic
1088680068 11:112232380-112232402 TTTCAATAACTGTTTGATCTAGG + Intronic
1089979820 11:122763133-122763155 GTGCAAAAACTCATTGATCTTGG + Intronic
1091010549 11:131997000-131997022 GTTCATAAAGTGATTGATCATGG - Intronic
1091043748 11:132306875-132306897 TTTCAATAACTGAGTGCTCATGG + Intronic
1091050726 11:132368092-132368114 CTTCAAAAATTAATAAATCAAGG + Intergenic
1094173683 12:27520997-27521019 CTTCAAAAAATGAAGTATCATGG + Intergenic
1094382379 12:29856689-29856711 TTTCTAGAACTGATTGATGATGG + Intergenic
1099301203 12:80896710-80896732 TATCAAAAACTAAATGATCATGG + Intronic
1099305432 12:80949056-80949078 CTTCAAAAACTGATTAAACCTGG - Intronic
1101395042 12:104339421-104339443 CTTTCAATACTGATTGCTCATGG + Intronic
1104091409 12:125520885-125520907 CTTCAAAAACTAAATGACCCTGG - Intronic
1106263095 13:28085494-28085516 CTTCAATAATTGATAGAACAAGG - Intronic
1107161170 13:37229882-37229904 CTTCAGGAACAGTTTGATCAAGG + Intergenic
1108033882 13:46266737-46266759 CTTGAAAAACTGACTGTTGATGG + Exonic
1108463506 13:50691835-50691857 CTTTATAAACTGATATATCATGG + Intronic
1108827792 13:54436416-54436438 CTTCACAAACTGATAGAACTTGG + Intergenic
1109239793 13:59871732-59871754 CTTCAAAAACAGAAAGAACAAGG - Intronic
1109398122 13:61787661-61787683 CATGAAAAACTGATAAATCAAGG + Intergenic
1111438587 13:88246278-88246300 CTTCACAAACTGTTAGAACAGGG - Intergenic
1115326632 14:32146319-32146341 ATTCAAAAGCAGTTTGATCAAGG + Exonic
1116016240 14:39410736-39410758 CTTCCAAAACTGAATCATGAAGG - Intronic
1117646720 14:57860887-57860909 ATTAATAAAATGATTGATCATGG - Intronic
1118202754 14:63692291-63692313 ATTTAAAAACTGGTTGATTAAGG - Intronic
1119136885 14:72229344-72229366 GTTCAAGATCTGCTTGATCAGGG - Intronic
1121587885 14:95076061-95076083 CTTCTAATAATGACTGATCAGGG - Intergenic
1121781151 14:96623460-96623482 TTTCAACAACAGATTGATCTGGG + Intergenic
1123400726 15:19982737-19982759 CTTCAAAATGTGATACATCATGG - Intergenic
1130122128 15:81060087-81060109 ATCCAAAAACTGATTGACTATGG + Intronic
1131622548 15:94082865-94082887 CATCCACAATTGATTGATCAGGG + Intergenic
1132280238 15:100607213-100607235 ATTAAAAAACTGATAGCTCATGG - Intronic
1134333527 16:13272107-13272129 GTTCTAAAACTGATTTATGACGG + Intergenic
1135476312 16:22778984-22779006 TTTCAGAAATTGATGGATCAAGG + Intergenic
1137736513 16:50728139-50728161 CTTCAAATGCTGAATGACCATGG + Intronic
1139113112 16:63916714-63916736 CTTTGAAAACTGATTGAAGAAGG - Intergenic
1144049817 17:11488964-11488986 CTTCAGAAACAGACTCATCAGGG - Intronic
1145812886 17:27775113-27775135 CTTAAAGAACTAATTGCTCAAGG - Intronic
1150121011 17:62602704-62602726 CCTCAAAAACTTTTAGATCATGG - Intronic
1153314528 18:3708891-3708913 CTTTAAAAACAGATTTTTCAGGG + Intronic
1155036931 18:22032618-22032640 CTTCAAAATCTGACTCATAATGG - Intergenic
1155196935 18:23484505-23484527 CTTCAAAAACCTAAGGATCAAGG - Intronic
1155717347 18:28961464-28961486 CTTCAAAAACATGTTGAGCAAGG - Intergenic
1156583978 18:38411179-38411201 ATTTATAAACTGATTCATCAAGG + Intergenic
1157523664 18:48362572-48362594 CAGCAGAAACTGATTGTTCATGG - Intronic
1158845763 18:61441109-61441131 CTTCAAAAACTGATTGATCATGG + Intronic
1159274856 18:66205599-66205621 CTTCTAAAACTAATGGATGATGG + Intergenic
1159859213 18:73627367-73627389 ATTAAATAACTGATTCATCAGGG + Intergenic
1164998023 19:32737688-32737710 CTTCAAAAACTACTTGAACCAGG - Intronic
1165794299 19:38510005-38510027 CTTCAGAAAGGGTTTGATCAAGG + Intronic
1167777455 19:51569264-51569286 CTTGAAAAAATGCTTGATCTGGG + Intergenic
1168533970 19:57153544-57153566 CTTCAACAATGGATTGATCAGGG - Intergenic
1168558710 19:57364869-57364891 TTTCAAAAACTGGATTATCATGG - Exonic
1202676104 1_KI270711v1_random:8367-8389 CTTCAAAAACTGTATTCTCATGG - Intergenic
924979294 2:206733-206755 CTTAAAAAACTGTATTATCATGG - Intergenic
926954334 2:18277724-18277746 CTTCATTAACTGAGTAATCAGGG - Intronic
928745518 2:34409560-34409582 ATTCAAAACTTTATTGATCATGG + Intergenic
929518835 2:42628803-42628825 CTTCAAACACTAATTGCTCTAGG - Intronic
930299899 2:49602368-49602390 TTACAAAAAATCATTGATCAAGG + Intergenic
930435571 2:51337246-51337268 ATTCAATAACTGCTTGTTCATGG - Intergenic
930884919 2:56314598-56314620 ATTCTGAAACTGATTGACCATGG + Intronic
932254849 2:70275701-70275723 CTGCAGAAAATGATTGCTCAGGG + Intronic
932809661 2:74813983-74814005 CTGCAATAACTGATTGAACCAGG + Intergenic
933074497 2:77906237-77906259 TTTCAATAACTGGTTGATGAAGG + Intergenic
933281186 2:80334347-80334369 TCTCAAAAGCTGATTGTTCAAGG - Intronic
937555195 2:123145398-123145420 CTGCCAAAATTGATTAATCAGGG - Intergenic
940449215 2:153817360-153817382 CTTGCTAAACTGATTTATCAGGG - Intergenic
940759529 2:157721902-157721924 GTTGAAAAACTCATTGTTCATGG + Intergenic
940823316 2:158382203-158382225 CTTCAGAAATTGATTGCTTACGG - Intronic
945008507 2:205436332-205436354 CTTGAAAAACTTATTAATAATGG - Intronic
946478162 2:220028899-220028921 CATCAAGAAGTCATTGATCATGG - Intergenic
946485242 2:220094960-220094982 CTTCAAAAGCTGAAAGATAATGG + Intergenic
947870516 2:233435075-233435097 CTATAAAAAATGATTTATCAAGG - Intronic
1169024222 20:2353936-2353958 ATACAAACACTTATTGATCAAGG + Intergenic
1169732126 20:8797860-8797882 CTACAACAACTTAATGATCAGGG - Intronic
1171188273 20:23138985-23139007 CTCCAAAAGCTGTCTGATCAAGG + Intergenic
1173212846 20:41050316-41050338 CTTAAAAAACTGATGAATGAGGG - Intronic
1177308648 21:19355783-19355805 CTTCAAAAACTGGCTCATCTCGG + Intergenic
1177422274 21:20875239-20875261 GTTCAAAAATAAATTGATCAAGG - Intergenic
1177451561 21:21274771-21274793 CTTAAGACACTGATTGATCTTGG - Intronic
1179766719 21:43579245-43579267 CTTCATTAACTCATTGATGAAGG - Intronic
1182338551 22:29601621-29601643 CCACCAAAACTGATTGCTCAGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1184999327 22:48234407-48234429 CTGCATGAACTGAATGATCAAGG - Intergenic
949237068 3:1822147-1822169 CTTCAAAAACTGGCTCTTCATGG - Intergenic
955076602 3:55619658-55619680 CTTCAGAAACTGTTGGAACATGG + Intronic
955707230 3:61740399-61740421 CTTATAAAACTGATTTATAATGG - Intronic
956492694 3:69790619-69790641 TGTCAAAAACTGATTGTCCATGG - Intronic
956884171 3:73542392-73542414 CTTCAGTAACTGATTGTTCTAGG + Intronic
959524490 3:107361289-107361311 ATTTAAAAACTAGTTGATCATGG + Intergenic
961590284 3:127974586-127974608 ATTCACAACCTGATTGCTCAGGG + Intronic
967065847 3:185914464-185914486 CTTCATCAACTGATTACTCATGG + Intergenic
967947310 3:194814251-194814273 CAACAAAAATTGAATGATCATGG + Intergenic
968209325 3:196834888-196834910 TTTCAAAACCTAGTTGATCACGG + Intergenic
970135872 4:12923192-12923214 CCTCCAGAACAGATTGATCAGGG + Intergenic
971089950 4:23330408-23330430 CTTCAGATACAGATTCATCAAGG - Intergenic
972554695 4:40170190-40170212 CTAAAAAAACTGAATGATTAAGG - Intergenic
974524882 4:63036958-63036980 TTTCAGAAACTAATAGATCAAGG - Intergenic
975664300 4:76719771-76719793 CTTCAAAAACTGTTTCAGAATGG + Intronic
977088920 4:92644690-92644712 TTTCAAATACTTATTGATAATGG + Intronic
977126640 4:93177135-93177157 CTTCATAATCTGAATGATCTTGG - Intronic
977367059 4:96083377-96083399 ATACAAAAATTGATTGATGATGG + Intergenic
977541798 4:98327002-98327024 CTTCATAAACAGGTTAATCAAGG - Intronic
980156286 4:129110889-129110911 ATTCAAAAACTGACTTATCCTGG + Intronic
981103497 4:140855593-140855615 CTTCAAAATATGATTAGTCATGG - Intergenic
981335082 4:143560233-143560255 CTTCAAAAACTGATAGTTAATGG + Intergenic
982649344 4:158067222-158067244 CGTCAAAAACTGGTCAATCAAGG + Intergenic
983764347 4:171458854-171458876 CTTCAACAGCTCATGGATCAAGG - Intergenic
984094308 4:175414523-175414545 CTTCAAAAGCTAGTTGATCAAGG + Intergenic
984174664 4:176401848-176401870 CTTCACAAAATGAGTGATAAAGG - Intergenic
984748984 4:183253442-183253464 CTTCAAAAGCTGAGTGCTCTGGG - Intronic
984926681 4:184813277-184813299 CTTCCAATACTGATTGAATAAGG + Intronic
985172874 4:187170772-187170794 ATTCTAAAACTGATTCCTCATGG + Intergenic
986406578 5:7431766-7431788 CTTCAAAAAATACTTTATCATGG + Intronic
986583174 5:9286583-9286605 CTTCAAGAGCTGACTGACCAGGG + Intronic
987924815 5:24326719-24326741 ATTAAAAAACTGATGCATCAGGG - Intergenic
988116007 5:26891941-26891963 GTTCACAACCTGAATGATCAAGG + Intronic
988518508 5:31925447-31925469 CTTCAAAAATTAACTCATCATGG + Intronic
990173851 5:53085269-53085291 CATTACAAAGTGATTGATCAGGG + Intronic
990191289 5:53263078-53263100 GTTTAAAGACTGATGGATCAGGG - Intergenic
990260628 5:54017939-54017961 CTTCAAATCCTGATTGTTTATGG - Intronic
990429446 5:55719724-55719746 CTTTTAAAACTTATTGAACAGGG + Intronic
991274368 5:64826569-64826591 TCAAAAAAACTGATTGATCAAGG - Intronic
991984367 5:72268613-72268635 CTTCAAAAAATTATGGATCAAGG + Intronic
994830323 5:104773821-104773843 CTTCAAAGACTTAGTGCTCAGGG - Intergenic
996097250 5:119411825-119411847 CTTCTTAAATTGATTTATCATGG - Intergenic
996230214 5:121054051-121054073 ATTTAAAAACTGGTTGCTCAGGG + Intergenic
998717685 5:144904663-144904685 CTGGAAAAACTGCTTGAACATGG + Intergenic
1001406874 5:171482709-171482731 GTTCAGAAACAGATTGACCAAGG - Intergenic
1001441186 5:171744238-171744260 CTTCAGGAACTGATGGATCCAGG + Intergenic
1007211850 6:40198591-40198613 CTCCAAGAAATGATTGCTCAGGG - Intergenic
1008246085 6:49175456-49175478 TTTCAAAAAGTTAATGATCATGG + Intergenic
1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG + Intronic
1009623973 6:66112899-66112921 CTTTAAAATATGAGTGATCAAGG + Intergenic
1010080991 6:71862221-71862243 CTTCAGTAATTGATAGATCAAGG - Intergenic
1011759793 6:90550276-90550298 CTTCAATAACTCTTTAATCAGGG + Intronic
1012039712 6:94188668-94188690 CTTCAAATAAAAATTGATCAAGG - Intergenic
1012291391 6:97459741-97459763 CTTCACAAAATGATTGTTCTGGG - Intergenic
1013244431 6:108273401-108273423 CTTCAAAACCTGGTTGAGCATGG + Intergenic
1014595027 6:123324954-123324976 CTTCAGAAAATGAGTAATCATGG + Intronic
1014963544 6:127717264-127717286 CTTAAATAACTAATTGCTCATGG + Intronic
1015247346 6:131089509-131089531 CTTCAAAAACTAATGAATCCAGG + Intergenic
1018934523 6:168265134-168265156 CTTCAAACACCGATTGATTAGGG + Intergenic
1019116310 6:169765450-169765472 CTTCAGAAGCTTATTTATCATGG + Intronic
1019331099 7:461220-461242 CTTCAAGGACAGCTTGATCAAGG + Intergenic
1020491323 7:8787739-8787761 ATTCAAATACTAATTGAGCATGG - Intergenic
1021282415 7:18737188-18737210 CTTCAAAAAATCAATGATCCAGG - Intronic
1021645693 7:22787309-22787331 CATCTAAAAATGATAGATCAGGG - Intergenic
1021705351 7:23362344-23362366 CTTACAAAACAGATTGCTCAAGG + Intronic
1022054496 7:26716201-26716223 TTTCAAAAACTGATAGACCAAGG - Intronic
1023050745 7:36248901-36248923 CTTCACAAACTCAGTGCTCAGGG + Intronic
1028201097 7:87962859-87962881 CTTCCTAAACTGAATGATCCTGG - Intronic
1030525050 7:110642739-110642761 CTTCAAAAATGGATTGATGTTGG + Intergenic
1033010636 7:137618944-137618966 ATTTAAAAACTGGTGGATCAGGG - Intronic
1033451927 7:141469817-141469839 TTTCACAAACTTATTGATGATGG - Intronic
1033783352 7:144699277-144699299 CCTTAAAATATGATTGATCAAGG + Intronic
1038981990 8:32769891-32769913 CTTCAAAACTTTATTCATCAGGG + Intergenic
1040489913 8:47910257-47910279 CTCCAAATACTTATTGACCAGGG - Intronic
1041152406 8:54949062-54949084 TTTCAAAAACTGAGTTATGAAGG + Intergenic
1042261074 8:66860046-66860068 TTTCAAACAGTGATTTATCATGG - Exonic
1043382351 8:79716442-79716464 TTTCTAAAACTGATTTGTCAGGG + Intergenic
1043773131 8:84229877-84229899 TTTCAAAATCAGATTTATCATGG - Intronic
1043847789 8:85181159-85181181 ATTCAAAAACTGTTTCTTCAAGG - Intronic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1047633702 8:126736006-126736028 CCTCAGAAAATGATTGGTCAGGG + Intergenic
1048610136 8:136013596-136013618 CCTCAAACTCTGATTGATAATGG - Intergenic
1050671732 9:8005321-8005343 CTTCAAAAATTGATGAATCCAGG - Intergenic
1051535696 9:18155072-18155094 CTTCAAAAACAAAATGTTCAAGG - Intergenic
1051767030 9:20535795-20535817 CTGCAAAAACTGTTTGATACCGG + Intronic
1052506197 9:29357774-29357796 CTTCAAAAATTAATGAATCAAGG - Intergenic
1054736457 9:68755843-68755865 CTTCAAATAGTCATTGATCCAGG + Intronic
1055239920 9:74171340-74171362 CTTGAGAAAATGATTGTTCAGGG - Intergenic
1056189914 9:84174908-84174930 CTTTAAAAACTGGGTGATTAGGG - Intergenic
1061121369 9:128644718-128644740 TTTCACAAACTGAAGGATCACGG + Intronic
1185967945 X:4628738-4628760 CAGCAGACACTGATTGATCATGG - Intergenic
1186451998 X:9681853-9681875 TCTCAGAGACTGATTGATCAAGG + Intronic
1186865840 X:13719906-13719928 TTTCAAAAACTGGATTATCATGG + Exonic
1188652177 X:32645065-32645087 CTTCTAAAGCTGTTTGATAACGG + Exonic
1191179851 X:57550034-57550056 CTTCATAAAATGATTTATGAAGG - Intergenic
1191748957 X:64520521-64520543 CATGAAAAACTGAAAGATCATGG + Intergenic
1192092969 X:68180613-68180635 CTTCACAAACTGTATGTTCATGG - Intronic
1192974679 X:76270457-76270479 CTTCAAAAATTAATTAATCCAGG + Intergenic
1193074397 X:77340156-77340178 TTTCAAAAACTGACAGATCCAGG + Intergenic
1194348709 X:92798348-92798370 CTTCAAAAACTGGTTATTAAAGG + Intergenic
1196626958 X:117887567-117887589 CCTCACAAACACATTGATCAAGG - Intergenic
1197631919 X:128870813-128870835 CTTCTAAAACTGATGCACCAAGG - Intergenic
1200150826 X:153950587-153950609 CTTCCAGAACTGACTAATCATGG + Intronic
1200657037 Y:5914971-5914993 CTTCAAAAACTGGTTATTAAAGG + Intergenic
1201787416 Y:17800639-17800661 TTTCAAAAACTGGTTTATCATGG + Intergenic
1201814137 Y:18105349-18105371 TTTCAAAAACTGGTTTATCATGG - Intergenic
1202349311 Y:23970618-23970640 TTTCAAAAACTGGATTATCATGG + Intergenic
1202521464 Y:25699486-25699508 TTTCAAAAACTGGATTATCATGG - Intergenic