ID: 1158847896

View in Genome Browser
Species Human (GRCh38)
Location 18:61463855-61463877
Sequence AGGGGCACATATTTTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158847896_1158847901 11 Left 1158847896 18:61463855-61463877 CCAATGGGAAAATATGTGCCCCT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1158847901 18:61463889-61463911 GAGAATTCTGCATCTTTAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 186
1158847896_1158847902 12 Left 1158847896 18:61463855-61463877 CCAATGGGAAAATATGTGCCCCT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1158847902 18:61463890-61463912 AGAATTCTGCATCTTTAGAAGGG 0: 1
1: 0
2: 2
3: 30
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158847896 Original CRISPR AGGGGCACATATTTTCCCAT TGG (reversed) Intronic
906145159 1:43556151-43556173 AGCTGCACATGTTTTCACATTGG + Intronic
907565452 1:55429738-55429760 GAGGGCACATATTTTCATATGGG + Intergenic
907706558 1:56837576-56837598 AGGGGAACAGTTTTTCCCCTAGG - Intergenic
908716360 1:67074142-67074164 AGTGGCACAAATTTTCACATTGG + Intergenic
908892275 1:68861185-68861207 AGGGGCAAATATTATCCAACTGG - Intergenic
911406001 1:97440283-97440305 AAGGGCAGAGATTTTCACATTGG - Intronic
914838368 1:151227084-151227106 AGGGACACATATTTTCCCTTTGG - Intronic
914888513 1:151602392-151602414 AGTCTCACACATTTTCCCATTGG + Intergenic
915326004 1:155081374-155081396 GGGGGCATATATTTGGCCATCGG - Intronic
918621777 1:186613710-186613732 AGGGGCATCTTTTTTCCCTTGGG + Intergenic
920816512 1:209339055-209339077 AAGGGTACATATTTTCAGATAGG - Intergenic
1065178399 10:23100693-23100715 ATGGGGACATATTTCCCCTTTGG - Intronic
1066306709 10:34151723-34151745 AGTGGATCAGATTTTCCCATAGG + Intronic
1066334975 10:34467013-34467035 AGATGCCCATACTTTCCCATAGG - Intronic
1067721129 10:48728450-48728472 AAGGCCACATACTTTCCCTTGGG + Intronic
1069610895 10:69771913-69771935 AGGAGCTATTATTTTCCCATCGG + Intergenic
1071079136 10:81789138-81789160 AGGGACACTTATTTTTCTATGGG - Intergenic
1073346622 10:102787719-102787741 AAGGGCACACATTTTCAAATTGG - Intronic
1074285400 10:112093032-112093054 AGGGGCACATAGTATCATATGGG + Intergenic
1074674292 10:115830786-115830808 AAAGGCACATAGTTTTCCATGGG - Intronic
1074809734 10:117091719-117091741 AAGGGACCATATTTTCCCAGTGG - Intronic
1078015443 11:7609426-7609448 AGGGAAACATATTTTTCCATTGG - Intronic
1085834879 11:79942723-79942745 AAAGTCACATATTTTCACATTGG + Intergenic
1086952786 11:92908211-92908233 AGGAAAACATATTTTTCCATAGG + Intergenic
1089122417 11:116146650-116146672 AGGGGCAAATATTATCCAACTGG + Intergenic
1094469066 12:30785989-30786011 AAGGTCACATATCTTCCCAGGGG - Intergenic
1094757322 12:33486895-33486917 ACAGGAAAATATTTTCCCATTGG - Intergenic
1096455900 12:51786186-51786208 AGTTACTCATATTTTCCCATTGG + Intronic
1101807709 12:108079021-108079043 AGTGAGACATATTGTCCCATTGG - Intergenic
1102032319 12:109748126-109748148 ATGATCACATTTTTTCCCATCGG + Intronic
1104811944 12:131624516-131624538 AGGGGCTCATAGATGCCCATGGG + Intergenic
1106203122 13:27560808-27560830 AGGCTATCATATTTTCCCATAGG - Intronic
1107415715 13:40198407-40198429 AAGGGCACAGATTTTGACATGGG - Intergenic
1111866796 13:93778800-93778822 ATTCCCACATATTTTCCCATGGG - Intronic
1112734560 13:102401659-102401681 AGGGGCACCGGTTTTACCATAGG + Exonic
1115193827 14:30775147-30775169 AGAGGCATATATTTACCCTTTGG - Intergenic
1115266431 14:31505491-31505513 AGGAACACATATTTTCAAATAGG - Intronic
1116994749 14:51311298-51311320 AGGGGCAGTCATGTTCCCATGGG - Intergenic
1118939085 14:70316052-70316074 AGGAGCACATTTTTTCCACTGGG - Intergenic
1120442563 14:84558875-84558897 AGGGGAACAGATATTCCTATGGG + Intergenic
1120912616 14:89681424-89681446 AGAGCCACATATTTTTCCTTAGG - Intergenic
1122009508 14:98734426-98734448 AGAGGCACCTATTTTGCCAAAGG - Intergenic
1122632090 14:103111776-103111798 AGGGGCATGTCTTTTCCCAGGGG + Intergenic
1124642119 15:31402241-31402263 GGGGGCACATCTTCTCCCAGAGG - Intronic
1127251211 15:57240262-57240284 TGGGGCTTATATTTTACCATGGG + Intronic
1128695215 15:69756740-69756762 CTGGGCACATATGTTTCCATTGG + Intergenic
1129773790 15:78220224-78220246 AAAGACAAATATTTTCCCATTGG - Intronic
1131968993 15:97873904-97873926 AGGGGCATATATTTTTACAAAGG - Intergenic
1133465776 16:6025651-6025673 ATGGCCACAGATTCTCCCATTGG + Intronic
1133516981 16:6518984-6519006 AGGGGGAAATATTTTCTCAGTGG + Intronic
1134645734 16:15864237-15864259 AGTGGCACATGTATTCCAATGGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137734366 16:50713052-50713074 AGGGGCACAGATTCTCCAAAGGG - Intronic
1140597247 16:76431146-76431168 AGTTGCAGATATTTTCACATGGG + Intronic
1141279984 16:82622745-82622767 AGGGGCTCATATTTCCTCCTAGG + Intergenic
1143013969 17:3881920-3881942 AGGGGCAGAAATTTTCCTAAAGG + Intronic
1143047723 17:4095581-4095603 AGGGGCACACATCTTCACAATGG - Intronic
1145908055 17:28527090-28527112 AAGGGCAGAGATTTTCCCAAGGG - Intronic
1150220585 17:63493729-63493751 AGGGGCACTTAGTGGCCCATGGG + Intronic
1150410285 17:64936198-64936220 ATGGGCAGAGATCTTCCCATTGG - Intergenic
1151345636 17:73499612-73499634 AGGCACACATGGTTTCCCATTGG - Intronic
1153335436 18:3919247-3919269 AGGGTTACAAATTTGCCCATAGG - Intronic
1154109968 18:11559415-11559437 AGGTGCACAGATTTTTCCTTTGG - Intergenic
1155254420 18:23982303-23982325 AGGGGCACAGATCCTCCCAGGGG + Intergenic
1156354352 18:36328713-36328735 AGAGCCACATGTTTTCCCAATGG + Intronic
1158847896 18:61463855-61463877 AGGGGCACATATTTTCCCATTGG - Intronic
1160239984 18:77116304-77116326 AGGGCCCCATGTTTTCACATGGG + Intronic
1162992124 19:14310293-14310315 TGGGCAACATATTGTCCCATGGG - Intergenic
1163588590 19:18177564-18177586 AGTGGCACATCTTTCCCAATGGG - Intronic
1165186063 19:34022787-34022809 AGGGGCAAATCTGTTGCCATTGG + Intergenic
1165863901 19:38924331-38924353 GGGGGCAGAGATTTTCCCAAGGG - Intronic
1165985629 19:39766511-39766533 AAGCACACATATTATCCCATGGG + Intergenic
926384909 2:12326616-12326638 AGTGGCACATATTCTGCCCTCGG - Intergenic
926743136 2:16128710-16128732 AGGGGTACATCTTTGCCCAGAGG - Intergenic
927199901 2:20571683-20571705 AGGGGCACAGAAGTACCCATGGG - Intronic
927499107 2:23570544-23570566 AGGGCCACACAGTTTCCCCTTGG + Intronic
928186965 2:29119026-29119048 AGGGGTACATAGTTTCCTTTGGG + Intronic
930172087 2:48262360-48262382 AGGGGCACATCTTTAACCTTGGG + Intergenic
931951272 2:67365313-67365335 GATGGCACATATTTTTCCATTGG - Intergenic
933077442 2:77946979-77947001 AGGAACAAATAATTTCCCATAGG - Intergenic
933305312 2:80589839-80589861 AGAGGTACATATTTTTCCAAAGG - Intronic
935092770 2:99912246-99912268 CTGGGCAAATATTTTCGCATGGG - Intronic
936600870 2:113893080-113893102 TGGGGCACATAGATTCCCATTGG + Intronic
938803565 2:134785843-134785865 AAGGGCACACATGATCCCATTGG + Intergenic
944357464 2:198808508-198808530 AGGGGAAAATGTTCTCCCATTGG + Intergenic
945131018 2:206572214-206572236 TAGTGCTCATATTTTCCCATTGG + Intronic
945996061 2:216437167-216437189 ATTGGCACATTTTTACCCATTGG + Intronic
947627283 2:231627945-231627967 ATGCGCAGAGATTTTCCCATGGG - Intergenic
948138398 2:235654405-235654427 AGGGAAACAGATTTTCCAATTGG + Intronic
948785705 2:240351552-240351574 AGGGGCACACGTCTTCCCTTTGG + Intergenic
1172108605 20:32531868-32531890 AGGGGGACACATTTTGTCATGGG - Intronic
1172420419 20:34812311-34812333 AGCTGCACAAATTTTCCCTTGGG - Intronic
1172675327 20:36666164-36666186 AGGGGCTCACATTTTCACCTCGG + Intronic
1172861516 20:38057414-38057436 AGGGGCACACATTTTCAGAATGG - Intronic
1175034444 20:55986898-55986920 AGAGTCACATTCTTTCCCATGGG - Intergenic
1176458311 21:6932170-6932192 AGGTGCACTTTTTTTCCCCTAGG - Intergenic
1176836485 21:13797264-13797286 AGGTGCACTTTTTTTCCCCTAGG - Intergenic
1177029069 21:15959611-15959633 CTGGGCACATATTTTGCCACAGG + Intergenic
1177864454 21:26496225-26496247 AGAGGCAAATATTTTCACAAAGG + Intronic
1177997307 21:28117143-28117165 ATGGGGACAGATTTTCCCTTTGG - Intergenic
1178019630 21:28394230-28394252 GGGGTCCCCTATTTTCCCATGGG - Intergenic
1178643833 21:34368164-34368186 AGGGGCTCATCTTTTCCACTCGG - Intronic
1178797673 21:35760050-35760072 ATGGGGACAGATTTTCCCCTTGG + Intronic
949675668 3:6450048-6450070 AGGGGCAATTATTTCCCCAAGGG + Intergenic
949799926 3:7892575-7892597 AAAAGCACATATTGTCCCATAGG - Intergenic
954542334 3:51402198-51402220 AGGGGAAAATATTTTCCCTTTGG - Intronic
954542335 3:51402201-51402223 AAGGGAAAATATTTTCCCCTTGG + Intronic
958113574 3:89184199-89184221 AAGGGAAAATATTTTCCCTTAGG - Intronic
958577205 3:95966226-95966248 AGGCCCACATATTTTCCCCTGGG + Intergenic
964770977 3:160224764-160224786 GGGGACGCATATTTTCCCAGTGG - Intergenic
966686486 3:182701448-182701470 AGGGAAACATATTTTTCAATGGG - Intergenic
969131691 4:4995150-4995172 AGGGGCACATGCCTGCCCATGGG - Intergenic
971636923 4:29072984-29073006 TGGGGCACATGTTTCCCCATAGG + Intergenic
976455730 4:85245271-85245293 AAGGGCAGATATTTTCAAATGGG - Intergenic
977359425 4:95983949-95983971 AAGGCCACATATCTTCCCAGGGG - Intergenic
978403284 4:108353142-108353164 TGAGGCAAATATTTGCCCATAGG - Intergenic
982043980 4:151423512-151423534 AAGGTCACATATTTACCAATTGG - Intronic
982641241 4:157964286-157964308 TGGTGCACATATTTGCCCTTTGG - Intergenic
984535664 4:180972018-180972040 AAGGAAATATATTTTCCCATGGG + Intergenic
986365797 5:7029355-7029377 AGCAGCAAAAATTTTCCCATTGG - Intergenic
988271954 5:29028409-29028431 AGGAGCACAGATTTTGCAATTGG + Intergenic
997534345 5:134606013-134606035 AGAGGCACAGATTACCCCATTGG + Exonic
997642988 5:135461930-135461952 ATGGGCACATACTTTCCTATGGG + Intergenic
1007331346 6:41112145-41112167 AGGGATACAAATTTTCACATTGG - Intergenic
1010559149 6:77326471-77326493 AGGGGCTCTTATCTACCCATTGG - Intergenic
1011133736 6:84077219-84077241 AGGGACAGATTTCTTCCCATTGG + Intronic
1015012050 6:128361237-128361259 AGGGGAACAGATTCTCTCATAGG - Intronic
1016951048 6:149580481-149580503 AAGAACACATATTTTACCATGGG - Intronic
1021564423 7:22002858-22002880 AGTGTTGCATATTTTCCCATAGG - Intergenic
1023640029 7:42248256-42248278 AGTTGCTCATATTTTCCTATAGG + Intergenic
1024044419 7:45577046-45577068 AGGGGCTCATCTTATCCCAGGGG - Intronic
1027997841 7:85448404-85448426 TGGTGCACATATGTTCCCTTAGG + Intergenic
1028349322 7:89825096-89825118 AGGGGCACTTATTTTCCCTAAGG + Intergenic
1030860657 7:114621854-114621876 AAGGGGACATATTTTGCTATAGG - Intronic
1031148959 7:118030359-118030381 AAGGGGACATATTTTCACAGTGG - Intergenic
1031625158 7:123984261-123984283 ATGGGGACATATTTTACAATTGG - Intergenic
1033218916 7:139514909-139514931 AAGGGCACAAAGTTTCCCTTAGG - Intergenic
1034913267 7:155015854-155015876 AAGGGCAGATATTTTCCAAATGG - Intergenic
1036246772 8:7124441-7124463 AAGGGTACAAATTTTCCAATAGG - Intergenic
1038891150 8:31725675-31725697 ATGAGCACATATTTTTCCTTTGG - Intronic
1039631660 8:39119198-39119220 ATGGACATATATTTTCCCTTGGG + Intronic
1042881938 8:73502847-73502869 ATGGGCACATATTGTCACACTGG + Intronic
1051613899 9:18988823-18988845 AGCGAATCATATTTTCCCATAGG - Intronic
1052444374 9:28541339-28541361 AGGGACACATATTCTATCATAGG + Intronic
1059913628 9:119074702-119074724 AGGAGCATAAAATTTCCCATTGG + Intergenic
1187869535 X:23753030-23753052 AAGAGGACATATTTTCCAATTGG + Intronic
1192405343 X:70879801-70879823 ACGAGCACATATGTTCCCATTGG + Intronic
1193294868 X:79822202-79822224 AGGGGCACCTAACATCCCATTGG + Intergenic
1198734125 X:139767616-139767638 AGGGGCACACATTTATCAATGGG + Intronic
1201276000 Y:12299455-12299477 AGGTGCATAGATTTTCTCATTGG + Intergenic
1201627642 Y:16032439-16032461 ATGGGCCCCTATTTTTCCATTGG - Intergenic
1201631303 Y:16074317-16074339 AGGGGCAGCTTTTTTCTCATTGG - Intergenic
1201955378 Y:19617060-19617082 AGGACCATATATTTTGCCATAGG + Intergenic