ID: 1158851956

View in Genome Browser
Species Human (GRCh38)
Location 18:61503512-61503534
Sequence GGATCAATATGGCCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158851956_1158851962 16 Left 1158851956 18:61503512-61503534 CCCCCAGGGGGCCATATTGATCC 0: 1
1: 0
2: 1
3: 9
4: 78
Right 1158851962 18:61503551-61503573 CTGATACCCAAAGCTGTAGATGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158851956 Original CRISPR GGATCAATATGGCCCCCTGG GGG (reversed) Intronic
901197258 1:7447152-7447174 GGGGCAGTATGGCTCCCTGGGGG - Intronic
902655615 1:17865996-17866018 GGATAAAAATTGCCCCCTTGAGG + Intergenic
904266888 1:29323403-29323425 GCAGCAATATGGCCTCATGGAGG + Exonic
907359647 1:53904144-53904166 GGATTATTATGCCCCCCTTGTGG + Intronic
914820648 1:151099971-151099993 AGATCACTATTGCCCCCTGGTGG - Intronic
915718974 1:157969938-157969960 GGCTCACTATGGCCACCTAGTGG - Intergenic
918177588 1:182059182-182059204 GGATCAATATGGCACACTTGGGG - Intronic
920525746 1:206664570-206664592 GGATCAACATGGCACAGTGGAGG + Intronic
920894073 1:210026067-210026089 AGATTAATATGGCCACCTAGAGG - Intronic
921330092 1:214026946-214026968 TGGTGAAAATGGCCCCCTGGAGG - Intronic
923456561 1:234170065-234170087 GGATTAAGATGTTCCCCTGGAGG - Intronic
1064591406 10:16895597-16895619 GGATCATTATGTCTTCCTGGTGG + Intronic
1070174355 10:73957542-73957564 GGCTCTCTCTGGCCCCCTGGTGG + Intergenic
1074770230 10:116728910-116728932 GCATTAAGATGGGCCCCTGGAGG - Intronic
1077906755 11:6540118-6540140 GGATGAAAATGGCCCCCAGCAGG - Intronic
1083148480 11:60775528-60775550 GGTTCAATAGTGCCCCCTTGTGG - Intronic
1085014363 11:73163181-73163203 AGTTCAATCTGGCCCTCTGGAGG - Intergenic
1086932824 11:92711422-92711444 GTATCACTAGGGCCTCCTGGGGG - Intronic
1090274669 11:125410843-125410865 GGATCTGGATGGCTCCCTGGGGG - Exonic
1093177677 12:15931418-15931440 GGATAACTTTGGCCCCCTGTTGG - Intronic
1106675349 13:31952690-31952712 GGATCATGCTGGCCTCCTGGAGG - Intergenic
1109763463 13:66861667-66861689 GAAGCAACATGGCCCACTGGAGG - Intronic
1113992898 14:16042353-16042375 AGAACAATAGGGCCCCCTGCAGG - Intergenic
1114494124 14:23120937-23120959 GGGCCAATATTGCCACCTGGTGG - Intergenic
1117943324 14:60992089-60992111 GGATAAAGATGGAACCCTGGTGG - Intronic
1123582803 15:21731318-21731340 GGTTCCTTAGGGCCCCCTGGTGG + Intergenic
1123619453 15:22173914-22173936 GGTTCCTTAGGGCCCCCTGGTGG + Intergenic
1124140812 15:27075764-27075786 GTATCAGGATGGCTCCCTGGTGG + Intronic
1124552299 15:30693051-30693073 GGACCATTATGGCCCCCGGATGG + Intronic
1124553869 15:30708198-30708220 GGGTCTTTGTGGCCCCCTGGAGG + Intronic
1124677380 15:31697473-31697495 GGGTCTTTGTGGCCCCCTGGAGG - Intronic
1124678940 15:31712615-31712637 GGACCATTATGGCCCCCGGATGG - Intronic
1145227312 17:21140951-21140973 GGATCAATATGTGCTCCTTGTGG + Intronic
1146803878 17:35849670-35849692 GGAGCAATTTTGCCCCCTAGTGG - Intronic
1151602395 17:75114223-75114245 GGAGCTCTATCGCCCCCTGGTGG - Intronic
1156352156 18:36310881-36310903 GGGTGAAGATAGCCCCCTGGAGG + Intronic
1158851956 18:61503512-61503534 GGATCAATATGGCCCCCTGGGGG - Intronic
1161426750 19:4207886-4207908 GGCTCACTATGGCGCCCTGGCGG + Exonic
1166862293 19:45817370-45817392 GGACTAATGTCGCCCCCTGGAGG - Intronic
925759602 2:7171671-7171693 GGATCAAAATGGTTCCTTGGAGG - Intergenic
928394100 2:30930986-30931008 GGAGCCATGTGGCCGCCTGGAGG - Intronic
928575823 2:32654008-32654030 AGATCAATATGGGACCCTTGGGG - Intronic
928702436 2:33912531-33912553 GCATCAAAATGGCCCCATGGTGG + Intergenic
929900104 2:45993274-45993296 GGAGCAAGATGGGCTCCTGGAGG - Intronic
931152020 2:59585126-59585148 GGATCCAGAATGCCCCCTGGTGG + Intergenic
940342973 2:152600648-152600670 GGATCAATCTGGGACCCTGGAGG - Intronic
946270063 2:218584421-218584443 GGGTAAATTTTGCCCCCTGGAGG - Intronic
947163512 2:227238435-227238457 GGTTCAAGTTCGCCCCCTGGTGG + Intronic
948988494 2:241540265-241540287 GGCTCAGTCTGGACCCCTGGGGG + Intergenic
1173460907 20:43242758-43242780 GGATCATAATGCCTCCCTGGGGG + Intergenic
1178291826 21:31374702-31374724 GGAACAATCTGTCCCCCTGCTGG - Intronic
1178717203 21:34976499-34976521 GGAGCAATATTGCACCCAGGGGG - Intronic
1180314372 22:11265166-11265188 AGAACAATAGGGCCCCCTGCAGG + Intergenic
954334061 3:49905943-49905965 GGATCAAAAAGGCTTCCTGGAGG - Intronic
956676535 3:71738594-71738616 GGATCATTATGTCTTCCTGGAGG - Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
977492421 4:97731915-97731937 GGAGCATTTTGGCCCCATGGGGG - Intronic
981565521 4:146097409-146097431 GTATCTATATGCCCCCCTGATGG + Intergenic
984353900 4:178633455-178633477 GGATCAGTCAGGCCCCCTAGCGG + Intergenic
986419870 5:7569088-7569110 GGATCCATATGGCCTCATGGAGG + Intronic
991532544 5:67631972-67631994 GGATTAATTTGGTCCCCTGGAGG - Intergenic
992154943 5:73945698-73945720 GCATGAATAGTGCCCCCTGGTGG - Intergenic
992205985 5:74430585-74430607 GGTTCCATGTGGCCCCATGGTGG - Intergenic
992782862 5:80143735-80143757 GGGTCAAGATGGCCTCCTGCTGG - Exonic
992799706 5:80284830-80284852 GGTTCAATATAGGCACCTGGTGG + Intergenic
993639596 5:90386292-90386314 GCAGCAATAGGTCCCCCTGGTGG + Intergenic
995479640 5:112581565-112581587 GAAGCAATATGGCCTGCTGGGGG + Intergenic
996550496 5:124725141-124725163 GGAGCCATTTGGCCCCCTTGTGG - Intronic
996897188 5:128499042-128499064 GGCTCAATTTTGCCCCCTGCAGG + Intronic
997723120 5:136096833-136096855 GGTTGAATATGGCTTCCTGGTGG - Intergenic
1006402425 6:33825568-33825590 GGTTAAATATGGCCCTGTGGAGG + Intergenic
1011056921 6:83215253-83215275 GGAGCAATTTGGCCCCCAAGGGG + Intronic
1014757173 6:125314268-125314290 GAATCAAAGTGGCCCCCTGTGGG - Intergenic
1030706739 7:112700558-112700580 GGATCTTTATGGCTCCCTGTCGG + Intergenic
1034421515 7:150993452-150993474 GGACCTTTATGACCCCCTGGTGG + Intronic
1034494577 7:151411851-151411873 GGCACAAAGTGGCCCCCTGGTGG + Intergenic
1034520402 7:151614881-151614903 GGATCCACATGGCCCCTTTGAGG - Intronic
1039751063 8:40479165-40479187 GGATCAATATGGCTACGTGCAGG + Intergenic
1043934254 8:86125273-86125295 GGATCAATATCGCCTCCTGGTGG - Intronic
1053277331 9:36793458-36793480 GGGTCAATGGGGGCCCCTGGTGG - Intergenic
1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG + Exonic
1062214515 9:135381999-135382021 GGATCAATATGACACTCTGTGGG + Intergenic
1062542265 9:137046700-137046722 GGATCACTCTTGCCCCCTGGTGG - Intergenic
1187422834 X:19151081-19151103 GAATCAATATGGCCCCCAAGAGG - Intergenic
1187722847 X:22169982-22170004 GGATCAATATGGACCATTTGTGG + Intronic
1190470516 X:50774581-50774603 GGATATAAATGGCCACCTGGTGG - Intronic
1190618327 X:52261635-52261657 GGAGCAATATTGCCACCTGCAGG + Intergenic
1193073735 X:77333346-77333368 GGCTCCATGTGGCTCCCTGGTGG + Intergenic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic