ID: 1158859037

View in Genome Browser
Species Human (GRCh38)
Location 18:61574075-61574097
Sequence TAATTCCCACACATTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8889
Summary {0: 5, 1: 91, 2: 975, 3: 2875, 4: 4943}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859037_1158859042 6 Left 1158859037 18:61574075-61574097 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1158859042 18:61574104-61574126 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
1158859037_1158859044 10 Left 1158859037 18:61574075-61574097 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1158859044 18:61574108-61574130 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
1158859037_1158859046 12 Left 1158859037 18:61574075-61574097 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1158859046 18:61574110-61574132 TTCAAGATGAGATTTGGGTGGGG 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
1158859037_1158859043 7 Left 1158859037 18:61574075-61574097 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1158859043 18:61574105-61574127 TACAATTCAAGATGAGATTTGGG 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
1158859037_1158859045 11 Left 1158859037 18:61574075-61574097 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 1158859045 18:61574109-61574131 ATTCAAGATGAGATTTGGGTGGG 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859037 Original CRISPR TAATTCCCACACATTGTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr