ID: 1158859209 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:61575665-61575687 |
Sequence | GTCTGAAGATGCCTCTCTTT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158859209_1158859210 | -3 | Left | 1158859209 | 18:61575665-61575687 | CCAAAAGAGAGGCATCTTCAGAC | No data | ||
Right | 1158859210 | 18:61575685-61575707 | GACTCTTTCTCTAAACCTCCAGG | 0: 1 1: 0 2: 13 3: 34 4: 170 |
||||
1158859209_1158859211 | 1 | Left | 1158859209 | 18:61575665-61575687 | CCAAAAGAGAGGCATCTTCAGAC | No data | ||
Right | 1158859211 | 18:61575689-61575711 | CTTTCTCTAAACCTCCAGGAAGG | No data | ||||
1158859209_1158859214 | 30 | Left | 1158859209 | 18:61575665-61575687 | CCAAAAGAGAGGCATCTTCAGAC | No data | ||
Right | 1158859214 | 18:61575718-61575740 | CTCTACCGACACCTTGATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158859209 | Original CRISPR | GTCTGAAGATGCCTCTCTTT TGG (reversed) | Intergenic | ||