ID: 1158859209

View in Genome Browser
Species Human (GRCh38)
Location 18:61575665-61575687
Sequence GTCTGAAGATGCCTCTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859209_1158859211 1 Left 1158859209 18:61575665-61575687 CCAAAAGAGAGGCATCTTCAGAC No data
Right 1158859211 18:61575689-61575711 CTTTCTCTAAACCTCCAGGAAGG No data
1158859209_1158859214 30 Left 1158859209 18:61575665-61575687 CCAAAAGAGAGGCATCTTCAGAC No data
Right 1158859214 18:61575718-61575740 CTCTACCGACACCTTGATTTTGG No data
1158859209_1158859210 -3 Left 1158859209 18:61575665-61575687 CCAAAAGAGAGGCATCTTCAGAC No data
Right 1158859210 18:61575685-61575707 GACTCTTTCTCTAAACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859209 Original CRISPR GTCTGAAGATGCCTCTCTTT TGG (reversed) Intergenic