ID: 1158859211

View in Genome Browser
Species Human (GRCh38)
Location 18:61575689-61575711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859205_1158859211 18 Left 1158859205 18:61575648-61575670 CCAGCAACCACCAGAAGCCAAAA No data
Right 1158859211 18:61575689-61575711 CTTTCTCTAAACCTCCAGGAAGG No data
1158859209_1158859211 1 Left 1158859209 18:61575665-61575687 CCAAAAGAGAGGCATCTTCAGAC No data
Right 1158859211 18:61575689-61575711 CTTTCTCTAAACCTCCAGGAAGG No data
1158859204_1158859211 28 Left 1158859204 18:61575638-61575660 CCAAGAATTTCCAGCAACCACCA No data
Right 1158859211 18:61575689-61575711 CTTTCTCTAAACCTCCAGGAAGG No data
1158859207_1158859211 11 Left 1158859207 18:61575655-61575677 CCACCAGAAGCCAAAAGAGAGGC No data
Right 1158859211 18:61575689-61575711 CTTTCTCTAAACCTCCAGGAAGG No data
1158859208_1158859211 8 Left 1158859208 18:61575658-61575680 CCAGAAGCCAAAAGAGAGGCATC No data
Right 1158859211 18:61575689-61575711 CTTTCTCTAAACCTCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859211 Original CRISPR CTTTCTCTAAACCTCCAGGA AGG Intergenic