ID: 1158859212

View in Genome Browser
Species Human (GRCh38)
Location 18:61575700-61575722
Sequence TAGAGTTGATTCCTTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859212_1158859216 2 Left 1158859212 18:61575700-61575722 CCTCCAGGAAGGAATCAACTCTA No data
Right 1158859216 18:61575725-61575747 GACACCTTGATTTTGGATTCTGG No data
1158859212_1158859214 -5 Left 1158859212 18:61575700-61575722 CCTCCAGGAAGGAATCAACTCTA No data
Right 1158859214 18:61575718-61575740 CTCTACCGACACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859212 Original CRISPR TAGAGTTGATTCCTTCCTGG AGG (reversed) Intergenic