ID: 1158859213

View in Genome Browser
Species Human (GRCh38)
Location 18:61575703-61575725
Sequence CGGTAGAGTTGATTCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859213_1158859214 -8 Left 1158859213 18:61575703-61575725 CCAGGAAGGAATCAACTCTACCG No data
Right 1158859214 18:61575718-61575740 CTCTACCGACACCTTGATTTTGG No data
1158859213_1158859216 -1 Left 1158859213 18:61575703-61575725 CCAGGAAGGAATCAACTCTACCG No data
Right 1158859216 18:61575725-61575747 GACACCTTGATTTTGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859213 Original CRISPR CGGTAGAGTTGATTCCTTCC TGG (reversed) Intergenic