ID: 1158859896

View in Genome Browser
Species Human (GRCh38)
Location 18:61581948-61581970
Sequence CAAAGAGCCTTGTCCGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859896_1158859899 7 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859899 18:61581978-61582000 AACCCAGCCTCCCGGTGCCCGGG No data
1158859896_1158859903 16 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859903 18:61581987-61582009 TCCCGGTGCCCGGGCCCCGCAGG No data
1158859896_1158859897 -1 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859897 18:61581970-61581992 GCAGAGAAAACCCAGCCTCCCGG No data
1158859896_1158859898 6 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859896 Original CRISPR CAAAGAGCCTTGTCCGCAGA TGG (reversed) Intergenic
No off target data available for this crispr