ID: 1158859897

View in Genome Browser
Species Human (GRCh38)
Location 18:61581970-61581992
Sequence GCAGAGAAAACCCAGCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859893_1158859897 27 Left 1158859893 18:61581920-61581942 CCGAAAGGAGTTTGGGTTTGCTT No data
Right 1158859897 18:61581970-61581992 GCAGAGAAAACCCAGCCTCCCGG No data
1158859896_1158859897 -1 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859897 18:61581970-61581992 GCAGAGAAAACCCAGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859897 Original CRISPR GCAGAGAAAACCCAGCCTCC CGG Intergenic
No off target data available for this crispr