ID: 1158859898

View in Genome Browser
Species Human (GRCh38)
Location 18:61581977-61581999
Sequence AAACCCAGCCTCCCGGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859896_1158859898 6 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859898 Original CRISPR AAACCCAGCCTCCCGGTGCC CGG Intergenic
No off target data available for this crispr