ID: 1158859899

View in Genome Browser
Species Human (GRCh38)
Location 18:61581978-61582000
Sequence AACCCAGCCTCCCGGTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158859896_1158859899 7 Left 1158859896 18:61581948-61581970 CCATCTGCGGACAAGGCTCTTTG No data
Right 1158859899 18:61581978-61582000 AACCCAGCCTCCCGGTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158859899 Original CRISPR AACCCAGCCTCCCGGTGCCC GGG Intergenic
No off target data available for this crispr