ID: 1158862893

View in Genome Browser
Species Human (GRCh38)
Location 18:61610378-61610400
Sequence ACTTTTCCACAGACGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158862886_1158862893 17 Left 1158862886 18:61610338-61610360 CCAACATTTTTGGCACCAGGGAC 0: 97
1: 1128
2: 1753
3: 1325
4: 935
Right 1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG No data
1158862883_1158862893 19 Left 1158862883 18:61610336-61610358 CCCCAACATTTTTGGCACCAGGG 0: 92
1: 1129
2: 1623
3: 1244
4: 890
Right 1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG No data
1158862889_1158862893 2 Left 1158862889 18:61610353-61610375 CCAGGGACTGGTTTCGTGGAAGA 0: 103
1: 788
2: 1109
3: 1467
4: 1213
Right 1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG No data
1158862885_1158862893 18 Left 1158862885 18:61610337-61610359 CCCAACATTTTTGGCACCAGGGA 0: 94
1: 1145
2: 1678
3: 1314
4: 965
Right 1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158862893 Original CRISPR ACTTTTCCACAGACGCGGAG GGG Intergenic
No off target data available for this crispr