ID: 1158868961

View in Genome Browser
Species Human (GRCh38)
Location 18:61665752-61665774
Sequence CATCTGAGGGAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158868961_1158868977 26 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868977 18:61665801-61665823 GTGGGCAGCTTAGGCAAGGAGGG No data
1158868961_1158868976 25 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868976 18:61665800-61665822 TGTGGGCAGCTTAGGCAAGGAGG No data
1158868961_1158868969 7 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868969 18:61665782-61665804 CTTAACCCACTGGACACCTGTGG No data
1158868961_1158868974 22 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868974 18:61665797-61665819 ACCTGTGGGCAGCTTAGGCAAGG No data
1158868961_1158868970 8 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868970 18:61665783-61665805 TTAACCCACTGGACACCTGTGGG No data
1158868961_1158868968 -3 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868968 18:61665772-61665794 ATGAAGCTCTCTTAACCCACTGG No data
1158868961_1158868973 17 Left 1158868961 18:61665752-61665774 CCTTCCCCCTTCTCCCTCAGATG No data
Right 1158868973 18:61665792-61665814 TGGACACCTGTGGGCAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158868961 Original CRISPR CATCTGAGGGAGAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr