ID: 1158871877

View in Genome Browser
Species Human (GRCh38)
Location 18:61696127-61696149
Sequence TGTAAGGTACATCTCTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158871877_1158871880 18 Left 1158871877 18:61696127-61696149 CCAGTAAAGAGATGTACCTTACA No data
Right 1158871880 18:61696168-61696190 AACATCCCCTGTAGTTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158871877 Original CRISPR TGTAAGGTACATCTCTTTAC TGG (reversed) Intergenic
No off target data available for this crispr