ID: 1158878316

View in Genome Browser
Species Human (GRCh38)
Location 18:61753148-61753170
Sequence GCAGCAGTGGGCAAAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 405}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158878308_1158878316 16 Left 1158878308 18:61753109-61753131 CCATGGGTGCATCCCCTGAGAAG 0: 1
1: 0
2: 2
3: 9
4: 115
Right 1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG 0: 1
1: 0
2: 3
3: 53
4: 405
1158878311_1158878316 3 Left 1158878311 18:61753122-61753144 CCCTGAGAAGCGAAGCTCAGGCA 0: 1
1: 0
2: 1
3: 17
4: 128
Right 1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG 0: 1
1: 0
2: 3
3: 53
4: 405
1158878310_1158878316 4 Left 1158878310 18:61753121-61753143 CCCCTGAGAAGCGAAGCTCAGGC 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG 0: 1
1: 0
2: 3
3: 53
4: 405
1158878312_1158878316 2 Left 1158878312 18:61753123-61753145 CCTGAGAAGCGAAGCTCAGGCAG 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG 0: 1
1: 0
2: 3
3: 53
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158878316 Original CRISPR GCAGCAGTGGGCAAAGAGCC TGG Intergenic
900127417 1:1074660-1074682 GCAGCAGTGAGCAAAGGGCAGGG - Intergenic
900197900 1:1386386-1386408 ACAGCAGGGAGCAAGGAGCCCGG + Intronic
900714936 1:4138142-4138164 ACAGCAGTGGGGAATGAGCTGGG - Intergenic
900833079 1:4978983-4979005 ACAGCAGTGTGCAAAGATACTGG + Intergenic
901866457 1:12109925-12109947 GAGGCAGTGGGCCAAGGGCCTGG + Intronic
902061018 1:13642770-13642792 ACAGCAGAGGGCAAAGAAGCAGG + Intergenic
902144948 1:14390942-14390964 ACAGCAGTTGGCAAAGGGCCAGG + Intergenic
902360741 1:15941445-15941467 GCAGCAGTGGCCTGTGAGCCAGG + Intergenic
902465460 1:16614662-16614684 GAAGAAGTGGGCAAGGCGCCTGG - Intergenic
902509132 1:16956055-16956077 ACAGCTGTGGGCAAGGAGGCCGG + Exonic
902635962 1:17735363-17735385 TCTGCAGTGGGACAAGAGCCAGG - Intergenic
903535442 1:24063461-24063483 GCAGGGCTGGGCAAAGAGGCAGG + Intronic
905553574 1:38863080-38863102 GCAGCAGTGGACTAAGTGCTGGG - Exonic
905884315 1:41483602-41483624 GCAGTGCTTGGCAAAGAGCCTGG + Intronic
907221290 1:52908636-52908658 TCAGAAATGGGCAAAGGGCCAGG + Intronic
907311879 1:53543458-53543480 GCAGCAGTGGGAATGGAGCCAGG + Intronic
907408066 1:54265856-54265878 GCAGCACTGGGCAGACAGCAAGG + Intronic
907590355 1:55660977-55660999 TAAACAGTGGGCAAAGGGCCGGG - Intergenic
909227498 1:73044400-73044422 GCAGCACTGGGCTAAGTTCCAGG - Intergenic
911492085 1:98582539-98582561 TCAGAAGTGGGCAAAAGGCCAGG - Intergenic
912117499 1:106424964-106424986 GCAGCAGTGTTCAAATAGCCAGG + Intergenic
912710832 1:111948648-111948670 GCAGCAGAGGGAAAAGACCCTGG - Intronic
913939554 1:125087841-125087863 GCCGCGGCGGGCAAAAAGCCAGG + Intergenic
914044028 1:144076955-144076977 GCGGGGGTGGGCAAAAAGCCGGG - Intergenic
914133907 1:144883076-144883098 GCGGCAGGGGGCAAAAAGCCGGG + Intergenic
914361142 1:146937583-146937605 GGAGAGGTGGGCAAAGCGCCTGG + Intergenic
914491446 1:148153049-148153071 GGAGAGGTGGGCAAAGCGCCTGG - Intergenic
915009033 1:152667297-152667319 CCAGCTGTGGGCCAAGAACCAGG + Intergenic
915617624 1:157051703-157051725 GCAGCAGTGGGCTATGATCATGG + Intergenic
915955185 1:160214947-160214969 GCAGCAGTGGCCAGAGGGGCAGG - Exonic
916887199 1:169081596-169081618 ACAGCAGGGGGCTGAGAGCCTGG + Intergenic
917791633 1:178502908-178502930 GCAGCCTTGGGAAATGAGCCTGG - Intergenic
919530047 1:198705754-198705776 GCAGGAGTGGCCACAGAGGCAGG - Intronic
919886158 1:201936480-201936502 GGAGGAGTGGGGAAGGAGCCTGG - Intronic
919920540 1:202164255-202164277 CCAGCATCGGGCAAAGAACCAGG - Intergenic
919974793 1:202603395-202603417 GGAGCAGTTGGCACAGGGCCTGG - Intronic
920135225 1:203764044-203764066 GGAGAAGTGGGCAGAGACCCAGG + Intergenic
920375440 1:205505503-205505525 GCAGCAGAGGGAAAGGAGGCTGG + Intronic
920509510 1:206540497-206540519 CCCCCAGTGGGCAAACAGCCTGG + Intronic
920657978 1:207890570-207890592 ACAGCAGTGGGAAAATACCCAGG - Intronic
921940409 1:220833017-220833039 GCAGAAGTGGACTAAAAGCCAGG - Intergenic
923338133 1:232987160-232987182 GAGGCAGTGGGCAAAGGGGCTGG - Intronic
923612199 1:235505005-235505027 ACAGAACCGGGCAAAGAGCCGGG - Intergenic
1063901549 10:10737944-10737966 GCAGCGGTAGGCAGAGACCCAGG - Intergenic
1064424907 10:15222052-15222074 GCAGCTGTGGGCAGAAGGCCAGG + Intronic
1064686280 10:17865603-17865625 GGAGGAGTGGGCAAGGAGCCTGG + Intronic
1064733364 10:18356090-18356112 GGGGCAGTGGGCAGAGATCCAGG - Intronic
1065936801 10:30527695-30527717 GAAGCAGAGGGCAAAGAGACAGG - Intergenic
1066200826 10:33141561-33141583 CCAGCAGTGGTTACAGAGCCTGG + Intergenic
1066329768 10:34407670-34407692 GCAGAAATTGGAAAAGAGCCAGG + Intronic
1067231728 10:44416907-44416929 ACAGCATTAGGCAAACAGCCTGG - Intergenic
1067849655 10:49746642-49746664 ACAGCAGTGGGCTCAGAGCCAGG + Intronic
1067906367 10:50295057-50295079 GCAGAAGTGGGCCAGGTGCCTGG - Intergenic
1069578464 10:69547374-69547396 CCAGCAGTGAGCACAGGGCCTGG - Intergenic
1069957632 10:72061628-72061650 GGAGCAGCAGGCAAGGAGCCTGG - Exonic
1069960060 10:72074173-72074195 GCAGCAGTGGGCACACAGAAGGG + Intronic
1070766840 10:79061662-79061684 GCAGCAGGAGGCTCAGAGCCAGG + Intergenic
1070991259 10:80734228-80734250 TCAGGAGTAGGCAAAGAGGCTGG + Intergenic
1071728238 10:88220987-88221009 GCACCAGAGTGGAAAGAGCCTGG - Intergenic
1072744463 10:97930050-97930072 GCTGATGTGGGCAAAGTGCCTGG - Intronic
1073568480 10:104556035-104556057 GCAGCAGGGGACAAACACCCAGG - Intergenic
1074100414 10:110350191-110350213 GCAGGAGTGGGAAAAGGGCTGGG - Intergenic
1074440368 10:113472383-113472405 CCAGCAGGGGCCACAGAGCCTGG - Intergenic
1075092485 10:119451455-119451477 GCAACAGAGGGCACTGAGCCAGG - Intronic
1075435195 10:122434148-122434170 GCAGCAGTGGACAAACACCATGG - Exonic
1075731528 10:124639357-124639379 TCAGCAGTGGGCATGCAGCCCGG + Intronic
1076138259 10:128059610-128059632 GCTGCACTGGGCACAGAGTCTGG - Intronic
1076356425 10:129857021-129857043 CCAGCAGTGGGGGAAGGGCCTGG + Intronic
1076474384 10:130742312-130742334 GCAGCAGTGGCCACAGGACCTGG - Intergenic
1076618490 10:131771980-131772002 GCAGCTGGGGGCACAGAGCCTGG + Intergenic
1076719212 10:132385868-132385890 GCAGCACTGGCCAGAGAGCAGGG - Intergenic
1076732825 10:132446908-132446930 GCAGCAGGGGGCAGAAAGGCAGG - Intronic
1077230267 11:1455485-1455507 GCAGCAGTGGCCTGAGTGCCCGG - Intronic
1077673577 11:4179208-4179230 GCAGCAGTAGGCAGGGAGCTGGG + Intergenic
1077673584 11:4179256-4179278 GCAGCAGTAGGCAGGGAGCTGGG + Intergenic
1077673591 11:4179304-4179326 GCAGCAGTAGGCAGGGAGCTGGG + Intergenic
1077673598 11:4179352-4179374 GCAGCAGTAGGCAGGGAGCTGGG + Intergenic
1078797600 11:14608287-14608309 GCTGCAGTGAGCTATGAGCCTGG + Intronic
1078871304 11:15347742-15347764 TGAGCAGAGGGCAAAAAGCCTGG - Intergenic
1078895892 11:15596863-15596885 CCAGCAGCAGGGAAAGAGCCAGG - Intergenic
1079754222 11:24235258-24235280 GCTGCAGCAGGCACAGAGCCAGG - Intergenic
1080063703 11:27984688-27984710 GGAGAAATGGGCAAAGAGCCTGG - Intergenic
1081759235 11:45565416-45565438 GCAGCAGTGTGAATGGAGCCGGG - Intergenic
1083331608 11:61900957-61900979 GCTGCAGTGGACTCAGAGCCAGG + Intronic
1083674143 11:64316164-64316186 GCAGCACTGTGCCCAGAGCCTGG - Exonic
1085054199 11:73394551-73394573 GCAGCAGGGGCCAGAGAGCGAGG - Exonic
1085065790 11:73494570-73494592 GCAGCCTTGGGCAAAGAGCCAGG + Intronic
1085252247 11:75151504-75151526 ACAGCTGTTGGCACAGAGCCAGG + Intronic
1085304150 11:75475782-75475804 GCAGCAGGGGGCCATGAGCTAGG - Intronic
1085458342 11:76678358-76678380 GCAGCCCTGGGGAAAGGGCCAGG - Intergenic
1085712364 11:78841662-78841684 TCAGCTGTGGGAAAGGAGCCAGG - Intronic
1085858911 11:80209124-80209146 ACACCAGAGGGCAAAGAGACAGG + Intergenic
1085982800 11:81744739-81744761 GCAGCTGTGGACAGAGTGCCAGG - Intergenic
1086556969 11:88121867-88121889 GGAGCAGTGGGTTAAGAGCAGGG - Intronic
1088783923 11:113163795-113163817 GCAGCACTGGGCATACTGCCTGG - Intronic
1088893057 11:114059573-114059595 GCAGCTGTGGGCAGGGAGCCGGG + Exonic
1089136943 11:116256709-116256731 GGAGGAGGGGCCAAAGAGCCGGG + Intergenic
1089703278 11:120258722-120258744 GCAGCAGTGGCCTGAGTGCCTGG + Intronic
1089775062 11:120830270-120830292 GAGGCAGTGGGCACAGTGCCTGG - Intronic
1091425461 12:384296-384318 GCGGCAGTGGGCAACCAACCGGG + Intronic
1091623154 12:2105224-2105246 GCTGGAGAAGGCAAAGAGCCTGG - Intronic
1091798217 12:3309198-3309220 GCACCATTCGGCAAGGAGCCTGG + Intergenic
1091829513 12:3539738-3539760 GCAGCAGTGGGTGTAGAGCTGGG + Intronic
1091889304 12:4040416-4040438 GAAGCTTTGGGCAAACAGCCTGG + Intergenic
1092028360 12:5262180-5262202 TTAGCAGAGGGCAAAGAGCCAGG + Intergenic
1092170350 12:6370411-6370433 GCAGCAGGGTGCAAGGACCCTGG + Intronic
1092225883 12:6748186-6748208 GAAGAGGTGGGCAAAGATCCAGG + Exonic
1092604235 12:10101406-10101428 GCAGCAGTGAGCTAAGTTCCAGG - Intronic
1092659280 12:10722169-10722191 GCAGCCGTGGGCACAGAGAGGGG + Intronic
1092793970 12:12092537-12092559 CCAGGAGAGGCCAAAGAGCCAGG + Intronic
1094027771 12:25976814-25976836 GCAGCAGGGGGAAGAGAGGCTGG - Intronic
1095252175 12:39991625-39991647 GCAGCAGAGGACAAAGGGGCTGG - Intronic
1095711446 12:45292973-45292995 TGAGCAGTGGGCAGAGTGCCGGG + Intronic
1096169326 12:49454368-49454390 ACAGCAGTGGACAAAGAGGTAGG + Intronic
1097009146 12:55940223-55940245 GCAGCAATGGGCCAAGGGCCAGG - Intronic
1097284837 12:57869299-57869321 GAAGCAATGGGTAAAGGGCCGGG - Intergenic
1098068285 12:66643624-66643646 GCTGCAGTAAGCTAAGAGCCTGG - Intronic
1098445476 12:70561911-70561933 ACAGCAGTGGGCCATGTGCCTGG + Intronic
1100465073 12:94837110-94837132 GCCGCCATGGGGAAAGAGCCAGG + Intergenic
1100470832 12:94891438-94891460 GCAGCAGTGGGACAAGACCTGGG - Intergenic
1101022278 12:100565419-100565441 ACAGCAGTGAGAAATGAGCCTGG + Intergenic
1101175845 12:102150938-102150960 GCAGCAGTGGACAAACAAACAGG - Intronic
1101211900 12:102543198-102543220 ACAGCAGTGGGAAAAGGACCTGG - Intergenic
1102041212 12:109801976-109801998 GCAGCAGGGGGCCAAGAACTGGG - Intronic
1102196649 12:111030230-111030252 GCAGAAGCAGGCAGAGAGCCGGG - Intergenic
1103358982 12:120342578-120342600 GCCGCAGGGGGCAAGGGGCCAGG - Exonic
1103597846 12:122035023-122035045 GCAGCAGTGTGGAAACACCCTGG - Intronic
1103611975 12:122129569-122129591 GTAGCTGTGGGCAAAGGGACAGG - Exonic
1104643084 12:130479774-130479796 GCAGCAGAGAGGACAGAGCCGGG + Intronic
1105344281 13:19559792-19559814 GCAGCACTGTGCCCAGAGCCCGG + Intergenic
1105535753 13:21261782-21261804 GCAGCACTGTGCCCAGAGCCCGG - Intergenic
1107019042 13:35732769-35732791 GCAGAACTCGGCACAGAGCCTGG + Intergenic
1107166603 13:37289397-37289419 CCAGCAATGTGCAAAGAGCCTGG - Intergenic
1107973859 13:45670660-45670682 GCAGCAGGTGGCATAGGGCCCGG - Intergenic
1109173055 13:59119401-59119423 GGGGCAGAGGGCAGAGAGCCAGG + Intergenic
1109651697 13:65336297-65336319 ACTGCAGTGGGCACAGAGCCAGG + Intergenic
1113650720 13:112032434-112032456 GCAGCAGTGGGCCCAGAACCAGG + Intergenic
1114543899 14:23484215-23484237 TCAGCAGTGACCAGAGAGCCAGG - Intronic
1116492842 14:45526689-45526711 GCTGTAGTAGGCACAGAGCCAGG + Intergenic
1117809930 14:59535236-59535258 CCTGCAGTGGGCACACAGCCTGG + Intronic
1118843701 14:69530218-69530240 GAAGCACTGAGCAAAGAGCAGGG - Exonic
1119104411 14:71910662-71910684 GCAGCATTGGGTAAAGAGAGAGG + Intergenic
1119253523 14:73178481-73178503 CCAGAAGAGGGTAAAGAGCCAGG - Intronic
1120744282 14:88140002-88140024 GAAGATGTGGGCAGAGAGCCAGG - Intergenic
1120847265 14:89137719-89137741 GCACCAGTGGGCAAAGGGCCAGG + Intronic
1121638189 14:95467763-95467785 GCAGCTGTGGACAAAGGCCCTGG + Intronic
1122588943 14:102831588-102831610 GCAGCACTGGGCAGAGAGCAAGG - Intronic
1122746253 14:103898855-103898877 GGAGCAGTGAGCACACAGCCGGG + Intergenic
1122809230 14:104279856-104279878 ACAGCAGAGGGCACAGGGCCAGG - Intergenic
1122954991 14:105066364-105066386 TCAGCAGTGGGGACAGGGCCGGG + Intergenic
1123396702 15:19944203-19944225 GCCGCGGCGGGCAAAAAGCCGGG - Intergenic
1123855555 15:24407238-24407260 GCATCACTGGGGAAAGAGTCAGG + Intergenic
1123864086 15:24499428-24499450 GCATCACTGGGGAAAGAGTCAGG + Intergenic
1124504376 15:30260680-30260702 GCAGCTGTGGGCAGAGGACCAGG + Intergenic
1124620593 15:31271861-31271883 GAACCACTGGGCAGAGAGCCAGG - Intergenic
1124704780 15:31954546-31954568 GCAGCCGTGTGCAATGAGCATGG - Intergenic
1124739175 15:32277955-32277977 GCAGCTGTGGGCAGAGGACCAGG - Intergenic
1125891204 15:43268559-43268581 AAAGCAGTGGGCAAGGAGCTTGG - Intergenic
1125931025 15:43600258-43600280 GCAGCAGTGCTGAAAGAGCCAGG + Exonic
1125944189 15:43700074-43700096 GCAGCAGTGCTGAAAGAGCCAGG + Intergenic
1126973661 15:54149106-54149128 GCAGCAGGAGACAGAGAGCCAGG - Intronic
1127369883 15:58329924-58329946 GCAGCTGTAGGCCAGGAGCCAGG - Intronic
1127436637 15:58964616-58964638 AAAGCACTGGGCAAAGGGCCAGG + Intronic
1129241556 15:74255306-74255328 GCAGCGGTGAGCCAGGAGCCAGG + Intronic
1129741003 15:77989658-77989680 GCAGCAGTGGGCAGAGATGTGGG - Intronic
1129844716 15:78762894-78762916 GCAGCAGTGGGCAGAGATGTGGG + Intronic
1130257111 15:82330972-82330994 GCAGCAGTGGGCAGAGATGTGGG - Intergenic
1130979975 15:88805587-88805609 CCAGCATTGAGCACAGAGCCTGG - Intronic
1132309033 15:100842860-100842882 GCATCAGTGGGCAGAGAGAAAGG - Intergenic
1132970690 16:2687086-2687108 GCTGCAGTGGGGAAGGAGCGGGG - Intronic
1133045761 16:3087495-3087517 GCAGCAGGGCCCAGAGAGCCTGG - Intergenic
1133126744 16:3652184-3652206 GCAGCATTTGGTCAAGAGCCAGG + Intronic
1133128442 16:3662033-3662055 GCAGCAGCTGGCCAAGACCCAGG - Exonic
1133144089 16:3770721-3770743 GTAGCACTGGGCACTGAGCCAGG + Exonic
1133328961 16:4959269-4959291 GCAGGGGTGTGCACAGAGCCTGG - Exonic
1135117573 16:19736672-19736694 GCAGCACTCAGCAAAGTGCCTGG - Intronic
1135137901 16:19898326-19898348 GCAGCACTGGGCAGAGGGACAGG + Intergenic
1135324362 16:21516889-21516911 GTTGCAGTGAGCAACGAGCCTGG + Intergenic
1135991182 16:27219647-27219669 CCAGGAGTGGGCTAAGAGCTGGG + Intronic
1136173384 16:28502011-28502033 GCAGCTGTGGGCCATGAGGCTGG - Exonic
1136335846 16:29610155-29610177 GTTGCAGTGAGCAACGAGCCTGG + Intergenic
1136957532 16:34803335-34803357 TCCGCAGCGGGCAAAAAGCCGGG - Intergenic
1138055332 16:53827096-53827118 GCAGAATTGGGTAAAGAGCTAGG - Intronic
1138526830 16:57613538-57613560 GGAGATGAGGGCAAAGAGCCGGG - Intronic
1139267132 16:65650451-65650473 TCACCAGTCAGCAAAGAGCCTGG + Intergenic
1140143261 16:72280152-72280174 GCAGCAGTGGACTAAGTGCTGGG + Intergenic
1141167744 16:81671752-81671774 GCAGCAGAAGGCAAAGCTCCTGG - Intronic
1141190258 16:81819480-81819502 AAAGCAGTGGGCGAGGAGCCAGG - Intronic
1141505205 16:84472307-84472329 GCAGCAGTGGGCCAGGTGGCTGG - Intergenic
1141876022 16:86825140-86825162 GGAGCAGAGAGCAGAGAGCCTGG + Intergenic
1142036567 16:87865957-87865979 GTTGCAGTGAGCAACGAGCCTGG + Intronic
1142126627 16:88413821-88413843 GCAGCAGTGGGGAGAGCGACCGG + Intergenic
1142236542 16:88925154-88925176 TCCGCAGTGGGCAGAGGGCCGGG + Intronic
1142686931 17:1582694-1582716 GCAGCAGCAAGCACAGAGCCTGG + Intronic
1143115996 17:4582208-4582230 GCAGCAGTAGGGGCAGAGCCAGG + Intergenic
1143476044 17:7204561-7204583 GCAGCAGATGGCAAAGAGTGGGG + Intronic
1143697438 17:8630741-8630763 GCAGCAGTGCTAAAGGAGCCCGG - Exonic
1143873583 17:9975291-9975313 GCTGCAGTGAGCCAAGATCCTGG + Intronic
1144703227 17:17351861-17351883 GCTGCAGTGGGGAAGCAGCCAGG - Intergenic
1144959009 17:19034405-19034427 GCTGCTGTGGGCACAGAGCCCGG - Intronic
1144976150 17:19140119-19140141 GCTGCTGTGGGCACAGAGCCCGG + Intronic
1145262337 17:21361812-21361834 CCAGTAGTGGGCACAGTGCCTGG + Intergenic
1146263645 17:31437416-31437438 ACAGCAGGGCGCAGAGAGCCGGG - Intronic
1146593901 17:34153427-34153449 CCAGAAGAGGGCAGAGAGCCTGG - Intronic
1146624139 17:34423210-34423232 CCAGCACTGGGCCCAGAGCCTGG + Intergenic
1147056570 17:37839556-37839578 GCAGCAGTCGGGAAAGAGCATGG + Intergenic
1147120661 17:38333434-38333456 GCAGGAGTGGACAAGGAGCCAGG - Intronic
1147647203 17:42040856-42040878 CCAGCAGTGGGCAAGTGGCCCGG + Intronic
1147892232 17:43725519-43725541 ACAGCATTGGGCCAAGAGCCTGG + Intergenic
1148196852 17:45720217-45720239 GGAACAGTGGGCACAGAGTCAGG + Intergenic
1148515584 17:48213928-48213950 GCAGCAGTTGGCTCAGAGTCAGG - Intronic
1149371811 17:56002258-56002280 GCTGCAGTTGGCAAAGTGGCTGG - Intergenic
1149557498 17:57584495-57584517 GGAGCAGTGGGCACCCAGCCAGG + Intronic
1151996450 17:77612267-77612289 GCAGCACTCGGCAGAGGGCCAGG + Intergenic
1152400887 17:80065532-80065554 GCAGCAATGGGCCAGCAGCCTGG + Exonic
1152718024 17:81909162-81909184 GCACTAGTGGGCTAAGGGCCAGG - Intronic
1154107431 18:11534495-11534517 GCAGCAGTGGAGGAACAGCCAGG + Intergenic
1155381671 18:25229340-25229362 GTTGCAGTGGGCAAGGATCCAGG - Intronic
1156071812 18:33220456-33220478 GCAGCAGTGACCAAAAAGCAAGG - Intronic
1156153898 18:34278909-34278931 GCAGTACTGGGCATACAGCCAGG + Intergenic
1156500186 18:37552550-37552572 GCAGCAGAGGCCACACAGCCAGG - Intronic
1157221055 18:45828735-45828757 CCTGCAGTGGGCAGGGAGCCTGG + Intronic
1157314856 18:46578939-46578961 GAAGCAGTGGGGAAAGAGCTAGG - Intronic
1158154708 18:54412499-54412521 TCATCAGTGGGCAAAGAGTTGGG + Intergenic
1158418071 18:57267467-57267489 GGAGCAATGGGCAAACAGCAGGG + Intergenic
1158878316 18:61753148-61753170 GCAGCAGTGGGCAAAGAGCCTGG + Intergenic
1158973363 18:62688652-62688674 GCAGCGTTGGGGAAAGAGCATGG + Intergenic
1161701676 19:5799334-5799356 GCAGCATCGGGCACTGAGCCCGG - Intergenic
1162010694 19:7812583-7812605 GTTGCAGTGAGCAAACAGCCTGG - Intergenic
1162461562 19:10816929-10816951 GCAGCAGTGGGAGAAGGGCCGGG + Intronic
1162958293 19:14112081-14112103 GCACCAGAGGGGACAGAGCCTGG - Intronic
1163275651 19:16282593-16282615 GCAGCAGCAGGCCAAGTGCCAGG + Intergenic
1164432025 19:28197151-28197173 GCGGCAGTGGGCAGAGGCCCAGG + Intergenic
1164677399 19:30110827-30110849 GCAGCAGTGAGAAACGATCCGGG + Intergenic
1165285585 19:34839085-34839107 GCAGCAGAGGGCAAAGGGCGAGG + Intergenic
1165504538 19:36216995-36217017 GCTGCAGTGAGCAGAGATCCTGG + Intronic
1166022885 19:40049012-40049034 CCAGGAGTTGGCAAACAGCCTGG + Intronic
1166369641 19:42293722-42293744 GCAGCAGTGGGCGGGCAGCCGGG + Exonic
1167280077 19:48561971-48561993 GCAGGCGTGAGCAATGAGCCCGG - Intronic
1202683257 1_KI270712v1_random:29268-29290 GCGGGGGTGGGCAAAAAGCCGGG - Intergenic
1202683430 1_KI270712v1_random:29858-29880 GCGGCAGGGGGCAAAAAGCCGGG - Intergenic
925488866 2:4369285-4369307 GCTGCAGTAGGCATGGAGCCTGG + Intergenic
925627420 2:5855024-5855046 GCAGGAATGGGCAATGAGACAGG - Intergenic
926122566 2:10252782-10252804 GCAGCAGTGGGGAGAGGGGCAGG + Intergenic
926305163 2:11632867-11632889 CCTGCAGTGGGCAAAGCACCTGG - Exonic
926621097 2:15048063-15048085 CCAGCAGTGGGGAAACAGCAGGG + Intergenic
926682338 2:15673527-15673549 GCAGAAGAAGGCAAAGAGACTGG + Intergenic
927705760 2:25295387-25295409 GCAGCACTGGCCAGAGAGCCAGG - Intronic
927992274 2:27456587-27456609 CTATCTGTGGGCAAAGAGCCTGG - Exonic
929412002 2:41707442-41707464 GCAGCAGGAGGCAGAGATCCAGG - Intergenic
929457207 2:42074468-42074490 GAAGCCATGGGCAAGGAGCCTGG + Intergenic
929714371 2:44295384-44295406 GCAAAAATGGGCACAGAGCCTGG - Intronic
931673357 2:64669433-64669455 GCAGGAGTGGCCACAGAGCCTGG + Intronic
932216329 2:69968722-69968744 CCAGGAGTGGGCCAAGAGCTGGG - Intergenic
932609294 2:73187053-73187075 GCAGAATGGGGCAAAGAGCGGGG - Intergenic
933191235 2:79336471-79336493 ACAGCTGAGGGCAAAGAGCCAGG - Intronic
935583080 2:104775782-104775804 GAAGCAGTGGACAAAGGCCCAGG + Intergenic
936270787 2:111046950-111046972 GCAGCAGTGGGCATGGAGGCTGG + Intronic
936815610 2:116456765-116456787 GCAGCAGTGAGCTAAGTTCCAGG + Intergenic
938644953 2:133320916-133320938 ACAGGAATGGGCAAACAGCCTGG - Intronic
939371545 2:141307830-141307852 GCAGCAGTGGGCCAAGTGTGTGG + Intronic
939838432 2:147157266-147157288 GCAGCAGTGGGGACAGCTCCAGG - Intergenic
941124639 2:161570761-161570783 GCAGCAGTGGGCCAGGAGTGTGG + Intronic
941317063 2:164006870-164006892 GCAGAAGGGGGAAAAAAGCCTGG + Intergenic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
943898806 2:193405246-193405268 TCAGCAGTGAGTAAACAGCCTGG + Intergenic
944215260 2:197248097-197248119 GCAGCAGTAGGCAGGCAGCCAGG - Intronic
944653155 2:201851952-201851974 TAAACAGTGGGCAAAGGGCCGGG - Intronic
944992757 2:205256358-205256380 GTAGCAGTTGGCAAAGAGCCTGG - Intronic
945590187 2:211719524-211719546 GCAGCAGTGAACAAAGACCTGGG - Intronic
946409825 2:219510419-219510441 GCTGCAGAGGGCAAAGGGCATGG - Intergenic
946616773 2:221518337-221518359 GCAGGAGCGGGTAAAGAGCGGGG - Intronic
948052554 2:234989504-234989526 TACGCAGTGGGCAAAGGGCCAGG - Intronic
948709484 2:239817021-239817043 GCATCAGTGGGCACAGAGGCAGG - Intergenic
948718574 2:239881976-239881998 GCAGCAGCTGGCACAGAGGCGGG + Intergenic
948748535 2:240113213-240113235 AAAGCAGTGGGCACAGTGCCTGG - Intergenic
948868230 2:240785908-240785930 GCAGCAGAGGCCAAGGAGCCAGG + Intronic
948958775 2:241315828-241315850 GAAGCAGTTGGCAAAGGGGCGGG + Intronic
949052556 2:241904932-241904954 GCACCAGCAGGCAAAGAACCAGG - Intergenic
1168828599 20:831547-831569 GTAGCAGAGGGCACAGGGCCAGG + Intergenic
1169288405 20:4328528-4328550 GCAGCAGTGACTACAGAGCCGGG - Intergenic
1170799516 20:19579467-19579489 GCAGCAGTCAGCACAGGGCCTGG - Intronic
1171046462 20:21812601-21812623 ACAGCACTGGGCTAGGAGCCAGG - Intergenic
1172108236 20:32529274-32529296 GCAGCACTTGGCACTGAGCCTGG + Intronic
1172817730 20:37701731-37701753 GCAGCAATGGGTAAAAAGCAGGG + Intronic
1174305405 20:49611223-49611245 GCAGCAGTCCCCGAAGAGCCTGG - Intergenic
1176586746 21:8595231-8595253 GCCGCGGCGGGCAAAAAGCCGGG - Intergenic
1177304216 21:19291763-19291785 GCAGTACTGAGCAAAGAGCTTGG - Intergenic
1179795360 21:43779401-43779423 GCAGCAGTGAGCCAAGATCATGG - Intergenic
1179918715 21:44495279-44495301 GCAACGGTGGGGAGAGAGCCAGG - Intergenic
1180141426 21:45895820-45895842 GAAGCAGGGGGCAAAGCCCCAGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181312613 22:21953301-21953323 GCCTCAGTGGGCGAAGATCCAGG + Intergenic
1181405909 22:22685166-22685188 GCAGCAGTGAGGAGAGAGGCTGG + Intergenic
1181540937 22:23573019-23573041 GCACCAGTGGGAAAGTAGCCTGG - Intergenic
1181550848 22:23638381-23638403 GCACCAGTGGGAAAGTAGCCTGG - Intergenic
1181843190 22:25683010-25683032 GCAGCAGAGGTCAGAAAGCCAGG + Intronic
1182893287 22:33837108-33837130 GTAGCAGTGGGACAAGAGGCTGG - Intronic
1183980570 22:41537464-41537486 GGAGCAGTGGGAACAGGGCCTGG + Intronic
1184104695 22:42360570-42360592 ACAGCAGTGGGAAAACAGGCAGG + Intergenic
1184110204 22:42389740-42389762 GCAGCAGGAGGCAAAGGGCCTGG - Intronic
1184761641 22:46548086-46548108 GAAGCACTGGGCAATGAGTCAGG + Intergenic
1184956909 22:47894086-47894108 GCAGGATAGGGCAAAGAACCGGG - Intergenic
1185045910 22:48528694-48528716 TCAGCACTGTGGAAAGAGCCAGG + Intronic
950117278 3:10459509-10459531 GCAGCAGTAGGGAAAGAGTTGGG - Intronic
950131219 3:10547957-10547979 GGAGCACTGGGCAAGGAGTCTGG + Intronic
952865139 3:37850233-37850255 GCAGCTGTGAGCCAGGAGCCTGG - Intergenic
953814627 3:46144416-46144438 GCAGTAGTGGGCACAGAGGTGGG - Intergenic
954218559 3:49138174-49138196 GCTGCAGTGGGAGCAGAGCCAGG + Intergenic
954439834 3:50515838-50515860 GCAGCGGTGGGGAAAGGGGCGGG - Intergenic
954785545 3:53089795-53089817 GCAGCACTGGGCGAACAGCAGGG + Exonic
955187182 3:56725746-56725768 GCAGCAGTGAGAAAAGAGGACGG + Intergenic
955593322 3:60560989-60561011 ACAGCAGTGAGCAAAGTGCCAGG + Intronic
956105177 3:65809925-65809947 GCAGCAGTGGGAGAAGAGTTGGG - Intronic
957702193 3:83728277-83728299 GCAACAGTGGGAAAAGAACTTGG + Intergenic
958591628 3:96165928-96165950 GGAGCAGTGGACAAACAGCCAGG - Intergenic
960583848 3:119302984-119303006 GCTGCAGTGGGCAAGGGACCTGG - Intronic
962853773 3:139326851-139326873 GCAGCTGTGTGGAAAGGGCCAGG - Intronic
963945963 3:151145893-151145915 GCAGCAGGGAACAAAGAGGCAGG - Intronic
964284374 3:155101556-155101578 CCAGAAGTGGGGAATGAGCCAGG - Intronic
965451121 3:168839973-168839995 GCAATAGTGGGGAAGGAGCCAGG - Intergenic
967859802 3:194141886-194141908 GCAGGAGTGGGCAGAGCGGCGGG + Intergenic
968578106 4:1377260-1377282 GCAGCTGTGGACAATGTGCCAGG - Intronic
968603897 4:1522517-1522539 GCGGCAGAGGTCACAGAGCCTGG - Intergenic
970443711 4:16107085-16107107 GCAGAAGTGGCCAACGAGCCAGG - Intergenic
971372477 4:26029680-26029702 GCAGCAGCTGGCACACAGCCAGG - Intergenic
971766108 4:30834121-30834143 GAAGCAGTTGGAAAAGTGCCTGG - Intronic
972314959 4:37917586-37917608 GCCGCACAGGGCAGAGAGCCAGG + Intronic
973704962 4:53572136-53572158 ACAGGAGTTGGCACAGAGCCAGG - Intronic
973952386 4:56029485-56029507 GGAGCTGTGGGCCAAGAACCAGG + Intronic
974490463 4:62557726-62557748 GCAGCAGTGAGCTAAGTTCCAGG + Intergenic
974691798 4:65306004-65306026 GCAGCAGTGGTCTAAGGGCTAGG + Intergenic
976111154 4:81675144-81675166 GCAGCAAAGTGGAAAGAGCCGGG + Intronic
978769963 4:112445113-112445135 GCAACAATGGGCAAAGAAACTGG + Intergenic
978841050 4:113212845-113212867 GCAGCAGTGGGCATACAGAATGG - Intronic
982107274 4:152022039-152022061 CCAGCATTGGGCAAAGGGGCGGG - Intergenic
984925778 4:184805575-184805597 ACAGAAGAGGGCAATGAGCCTGG + Intronic
985877776 5:2613292-2613314 GCAACAGTGGGCACAGAGGCAGG - Intergenic
986717161 5:10533011-10533033 CCAGCAGTGGGCAGAGAGGCTGG + Intergenic
986890730 5:12301689-12301711 ATAGCAGTAGGCAAAGAGCAAGG - Intergenic
988906672 5:35797832-35797854 GCAGCACTGGGAGCAGAGCCAGG - Intronic
990728247 5:58780166-58780188 GCAACAGTGGTCAAATAGCAAGG + Intronic
990951647 5:61304548-61304570 GCAGCAGAGGGCAAAGCACCTGG - Intergenic
993554768 5:89322488-89322510 GCAACATTGGGAAAAGAGCAGGG - Intergenic
994860131 5:105181953-105181975 GCAGAAGTAGGCCTAGAGCCTGG - Intergenic
996734730 5:126748200-126748222 ACAGCAGGGGGCAAAAAGCCTGG + Intergenic
997432013 5:133847369-133847391 GCACCAATGGGCATAGTGCCTGG + Intergenic
998449878 5:142225990-142226012 ACAGCAGTGTACAAAGAGCAGGG + Intergenic
1000693828 5:164355468-164355490 GCAAAACTGGGCAGAGAGCCAGG - Intergenic
1001720721 5:173855020-173855042 GCTGCAGTGAGCCCAGAGCCTGG - Intergenic
1002128589 5:177065256-177065278 GCAGCAGTTGGCAACGAGCTGGG + Exonic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002575705 5:180172595-180172617 GCCCCAGCTGGCAAAGAGCCAGG + Intronic
1002801910 6:531224-531246 GGGGCAGTGGGCAGAGTGCCAGG + Intronic
1003512718 6:6794762-6794784 GCTGCAGTGTCCAAAGAGCTTGG + Intergenic
1003619027 6:7681065-7681087 CCAGCAATGGGCAATCAGCCAGG - Intergenic
1003677414 6:8218407-8218429 GCAGCAGTGTGCAGACAGCTTGG - Intergenic
1004434435 6:15577086-15577108 GCAGCAGAAGGGAACGAGCCAGG + Intronic
1004608756 6:17218825-17218847 GCAGCAATGGGCAAAGCACAAGG - Intergenic
1005061407 6:21780140-21780162 GCAGCAGTGGAAACCGAGCCTGG + Intergenic
1006213807 6:32421160-32421182 GCAGCACTGAGCTATGAGCCAGG + Intergenic
1006437072 6:34031223-34031245 GCACCAGCGGGCTAAGAGGCAGG - Intronic
1007113169 6:39325274-39325296 GCAGCAGAGGGCAATGGGCATGG - Intergenic
1007257824 6:40541048-40541070 ACTGCTGTGGGCACAGAGCCAGG + Intronic
1011328558 6:86177951-86177973 GGAGTAGTGGGAAAAGAGACTGG + Intergenic
1012055728 6:94407621-94407643 GCTGCAGTGAGCGAAGATCCTGG - Intergenic
1012568137 6:100685999-100686021 TCAATAGTGAGCAAAGAGCCTGG + Intronic
1015149151 6:130019476-130019498 GAGGCAGTGGGAAAAGAGGCCGG + Intronic
1016672205 6:146721972-146721994 GCAGCAGTGGGCATAATCCCTGG - Intronic
1017417950 6:154241921-154241943 GCAGCCTGGGGAAAAGAGCCTGG + Intronic
1018500792 6:164409338-164409360 GCAGCAGTGGTCAAAGAACAGGG + Intergenic
1019291338 7:252034-252056 GCAGCAGGGGCCCAGGAGCCCGG + Intronic
1020026985 7:4906239-4906261 GCAGCATTGGACAGAGAGGCTGG + Exonic
1020624305 7:10558618-10558640 TCAGCAGGTGGCAAACAGCCAGG - Intergenic
1023632839 7:42180652-42180674 GAGGCAGTGGGCACAGACCCTGG + Intronic
1024634759 7:51277780-51277802 AGAGCAGGGGGCACAGAGCCAGG + Intronic
1024947764 7:54828200-54828222 GCAGCAGTGTGTAAAGAACTTGG - Intergenic
1025481690 7:60991931-60991953 GCGGCGGGGGGCAAAAAGCCAGG - Intergenic
1027450340 7:78324433-78324455 CCAGCAGTGTGCAATAAGCCTGG - Intronic
1028447937 7:90946029-90946051 GCAGCAGTGGGGAAAAAGAAGGG + Intronic
1029607720 7:101609173-101609195 TCAGCAGTGGGGAAAGAGGAGGG + Intergenic
1029637148 7:101792612-101792634 GCGCCAGTGTGAAAAGAGCCGGG - Intergenic
1032978180 7:137249914-137249936 CCAGCAGTGGCCAAAAAGCCAGG + Intronic
1033047859 7:137978802-137978824 GCAGCACTGGGCACAGAGTGCGG + Intronic
1033237405 7:139649224-139649246 GCAGCAGTGGTCACCGAGTCAGG - Intronic
1034272822 7:149811676-149811698 GCTGCAGTTGGCGATGAGCCCGG - Intergenic
1034275367 7:149821609-149821631 GCAGGAGCTGGGAAAGAGCCGGG - Intergenic
1034936181 7:155202507-155202529 GCAGCACTGAGCACAGATCCTGG + Intergenic
1035027728 7:155836809-155836831 GCACCAGTGGGCATCAAGCCTGG - Intergenic
1036217957 8:6896561-6896583 GCAGCAGAGGCCAATGAGCTGGG + Intergenic
1036390071 8:8317619-8317641 GCAGCAGTCTGCAAAGGACCAGG - Intergenic
1037419614 8:18688156-18688178 GCAGCTATGAGCAAAGATCCTGG + Intronic
1037706307 8:21317836-21317858 GCAGCTCTGGGCAAAAAGTCTGG - Intergenic
1037765800 8:21771504-21771526 GCAGCACTGGGCAGAGAGGAGGG + Intronic
1038100239 8:24365120-24365142 GCTGCATTGTGCAAAGACCCTGG + Intergenic
1039930234 8:41979935-41979957 GCTGCAGTGAGCCAAGATCCTGG + Intronic
1040574451 8:48639179-48639201 GCAGCAATGGGCAAAGCGAAGGG - Intergenic
1040625986 8:49150604-49150626 GCAGGAGTGAGAAAAGAGGCCGG + Intergenic
1042330257 8:67572448-67572470 GCAGACATGGGCACAGAGCCAGG - Intronic
1042919143 8:73905419-73905441 GGAGCAGTGGGAACAGGGCCAGG - Intergenic
1043816976 8:84813077-84813099 GAAGCAGTGGGAAAAGCCCCGGG - Intronic
1046250471 8:111624287-111624309 GCAGCAGTCGGAGAAGAGCCGGG - Intergenic
1046986256 8:120391647-120391669 GCAGCAGTGAGCTAAGTTCCAGG + Intronic
1047501543 8:125445649-125445671 GCAGCAGCGGGGAAAGAGCAGGG - Intergenic
1047634426 8:126744662-126744684 GCAGCAATGGGCTAAGTTCCAGG + Intergenic
1048041395 8:130732275-130732297 GCAGGAGTAGGAAAAGAGTCTGG + Intergenic
1048251731 8:132871638-132871660 GCCGAAGTGGGCAGAGAACCAGG + Intronic
1048581880 8:135735633-135735655 GCAGCAGTGGGACAAGGGGCGGG - Intergenic
1049088652 8:140496930-140496952 CCAGCACTGGGCCAGGAGCCAGG - Intergenic
1049574206 8:143382956-143382978 GCAGCAGGGTGGACAGAGCCCGG - Exonic
1049974120 9:845692-845714 GAAGCAGTGGGGAAAGGGGCTGG - Intronic
1051922021 9:22277814-22277836 GTACCAGTGGGAAAAGATCCTGG - Intergenic
1052246551 9:26342767-26342789 GAAGCAATGGGCATATAGCCTGG + Intergenic
1053369239 9:37546740-37546762 GCTGCAGTGAGCAAAGATCATGG - Intronic
1053697238 9:40650169-40650191 GCAGCGAGGGGCAAAAAGCCGGG + Intergenic
1053697623 9:40651516-40651538 GCGGGGGTGGGCAAAAAGCCAGG + Intergenic
1053697637 9:40651559-40651581 GCGGCGGGGGGCAAAAAGCCGGG + Intergenic
1053943571 9:43280100-43280122 GCGGCGGGGGGCAAAAAGCCGGG + Intergenic
1054308489 9:63449404-63449426 GCAGCGAGGGGCAAAAAGCCGGG + Intergenic
1054308915 9:63450924-63450946 GCGGGGGTGGGCAAAAAGCCAGG + Intergenic
1054308929 9:63450967-63450989 GCGGCGGGGGGCAAAAAGCCGGG + Intergenic
1054407116 9:64773005-64773027 GCGGGGGTGGGCAAAAAGCCGGG + Intergenic
1054407595 9:64774658-64774680 GCGGGGGTGGGCAAAAAGCCGGG + Intergenic
1054407709 9:64775048-64775070 GCGGGGGTGGGCAAAAAGCCAGG + Intergenic
1054440748 9:65258516-65258538 GCAGCGAGGGGCAAAAAGCCGGG + Intergenic
1054440775 9:65258619-65258641 GCAGCGAGGGGCAAAAAGCCGGG + Intergenic
1054440844 9:65258861-65258883 GCGGGGGTGGGCAAAAAGCCAGG + Intergenic
1054489591 9:65763181-65763203 GCAGCGAGGGGCAAAAAGCCGGG - Intergenic
1056563246 9:87751136-87751158 TGAGCTGTGGGCAAAGTGCCAGG + Intergenic
1056946303 9:91000286-91000308 GCAGCTCTGGGAAATGAGCCGGG + Intergenic
1057080467 9:92171122-92171144 GGAGCAGTGCACAAAGGGCCTGG - Intergenic
1058486222 9:105445761-105445783 GCAGCAGTGGGCTAATGGCTTGG + Intergenic
1060436879 9:123600938-123600960 GGAGCAGTGGGCAGTGAGCAGGG - Intronic
1060660250 9:125401170-125401192 GCAGCTGTGGCCCCAGAGCCAGG - Intergenic
1061091117 9:128427066-128427088 CCAGCATTGAGCACAGAGCCTGG - Intronic
1061100190 9:128486287-128486309 ACAGCAGCTGGCATAGAGCCTGG - Intronic
1061678656 9:132231877-132231899 GCAGCCCTGGGCAGAGAGCAGGG + Intronic
1061768587 9:132899383-132899405 GCAGAAGAGTGGAAAGAGCCTGG + Intronic
1062006182 9:134239626-134239648 GCAGCAGTGGGAACACAGGCGGG - Intergenic
1062040977 9:134404200-134404222 GCAGCATTTGGCAGAGTGCCTGG - Intronic
1062101406 9:134730507-134730529 GGGGCAGTGGGCCAAGGGCCAGG + Intronic
1062190331 9:135244761-135244783 GCAGCAGCTGGCAAAGAGGCAGG + Intergenic
1062724443 9:138063705-138063727 ACAGCAGTGGGTACTGAGCCTGG + Intronic
1202779682 9_KI270717v1_random:23806-23828 GCAGCGAGGGGCAAAAAGCCGGG + Intergenic
1202779968 9_KI270717v1_random:24810-24832 GCGGGGGTGGGCAAAAAGCCAGG + Intergenic
1203586689 Un_KI270747v1:10003-10025 GCGGCGGGGGGCAAAAAGCCGGG + Intergenic
1203616554 Un_KI270749v1:72381-72403 GCCGCGGCGGGCAAAAAGCCGGG - Intergenic
1185734858 X:2488916-2488938 GCAGCAGGGGGAAGAGGGCCAGG + Exonic
1187878221 X:23821897-23821919 GCTGCAGTGGGCCATGAGCCTGG - Intergenic
1188272166 X:28153369-28153391 TAAAAAGTGGGCAAAGAGCCTGG + Intergenic
1192215280 X:69153664-69153686 ACAGCAGTGAGCAAAGGGCCTGG + Intergenic
1193251708 X:79298791-79298813 GCTGCAGCAGGCACAGAGCCAGG + Intergenic
1193300352 X:79881594-79881616 GCAGCAGTGGGTAAAGGGAGTGG - Intergenic
1195741571 X:108069990-108070012 ACAGCAATGGGCAAAGAACCAGG + Intronic
1197165190 X:123369286-123369308 GCAGAAGAGAGCCAAGAGCCAGG + Intronic
1198205251 X:134459801-134459823 GAAGCACTGGGCCAAGAGTCAGG + Intergenic
1199348604 X:146772748-146772770 ACAGCAGTGGCCAAATAGCCAGG + Intergenic
1199491504 X:148405270-148405292 GCAGAAGTATGGAAAGAGCCTGG - Intergenic
1199947561 X:152680760-152680782 TCAGCAGGAGGGAAAGAGCCGGG + Intergenic
1199962118 X:152787694-152787716 TCAGCAGGAGGGAAAGAGCCGGG - Intergenic
1200077099 X:153556635-153556657 GAAGCAGTGGGTCTAGAGCCAGG + Intronic
1200830458 Y:7684011-7684033 GCTGCAGTGGGCTGAGATCCTGG + Intergenic